EMAIL THIS PAGE TO A FRIEND

OR10V1

olfactory receptor, family 10, subfamily V, member 1

17 Gene Product Result for
Synonyms: OR11-256
UniProtKB ID: Q8NGI7, Q6IFD9, Q96R50
Gene ID:
Human(390201) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(788711) olfactory receptor, family 10, subfamily V, member 1
dog(483446) cOR10V6 olfactory receptor family 10 subfamily V-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372414 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372414 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372414 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005324 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005324 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052978 predicted 496
2 SASI_Hs01_00052979 predicted 575
3 SASI_Hs01_00052980 predicted 508
4 SASI_Hs01_00052981 predicted 356
5 SASI_Hs01_00052982 predicted 529
6 SASI_Hs01_00052983 predicted 517
7 SASI_Hs01_00052984 predicted 589
8 SASI_Hs01_00052985 predicted 204
9 SASI_Hs02_00304838 predicted 234
10 SASI_Hs01_00052987 predicted 336
11 SASI_Hs01_00052986 predicted 408
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372414
OR10V1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 10, subfamily V, member 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372414.1-583s1c1
Sequence:CCGGGTTCACAAGACTGCTCTGTATCTCGAGATACAGAGCAGTCTTGTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372414.1-199s1c1
Sequence:CCGGGCAGTTCTAGAAATCTTCTATCTCGAGATAGAAGATTTCTAGAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372414.1-642s1c1
Sequence:CCGGGATCTCCATCTCCTATGTCTTCTCGAGAAGACATAGGAGATGGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372414.1-496s1c1
Sequence:CCGGCATCTCCCATTCTGCCACAATCTCGAGATTGTGGCAGAATGGGAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372414.1-582s1c1
Sequence:CCGGCGTTCACAAGACTGCTCTGTACTCGAGTACAGAGCAGTCTTGTGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372414.1-242s1c1
Sequence:CCGGCCTTGGCAAACCTCCTTTCAACTCGAGTTGAAAGGAGGTTTGCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372414
OR10V1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 10, subfamily V, member 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372414.1-583s1c1
Sequence:CCGGGTTCACAAGACTGCTCTGTATCTCGAGATACAGAGCAGTCTTGTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372414.1-199s1c1
Sequence:CCGGGCAGTTCTAGAAATCTTCTATCTCGAGATAGAAGATTTCTAGAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372414.1-642s1c1
Sequence:CCGGGATCTCCATCTCCTATGTCTTCTCGAGAAGACATAGGAGATGGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372414.1-496s1c1
Sequence:CCGGCATCTCCCATTCTGCCACAATCTCGAGATTGTGGCAGAATGGGAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372414.1-582s1c1
Sequence:CCGGCGTTCACAAGACTGCTCTGTACTCGAGTACAGAGCAGTCTTGTGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372414.1-242s1c1
Sequence:CCGGCCTTGGCAAACCTCCTTTCAACTCGAGTTGAAAGGAGGTTTGCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372414
OR10V1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 10, subfamily V, member 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372414.1-583s1c1
Sequence:CCGGGTTCACAAGACTGCTCTGTATCTCGAGATACAGAGCAGTCTTGTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372414.1-199s1c1
Sequence:CCGGGCAGTTCTAGAAATCTTCTATCTCGAGATAGAAGATTTCTAGAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372414.1-642s1c1
Sequence:CCGGGATCTCCATCTCCTATGTCTTCTCGAGAAGACATAGGAGATGGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372414.1-496s1c1
Sequence:CCGGCATCTCCCATTCTGCCACAATCTCGAGATTGTGGCAGAATGGGAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372414.1-582s1c1
Sequence:CCGGCGTTCACAAGACTGCTCTGTACTCGAGTACAGAGCAGTCTTGTGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372414.1-242s1c1
Sequence:CCGGCCTTGGCAAACCTCCTTTCAACTCGAGTTGAAAGGAGGTTTGCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)