EMAIL THIS PAGE TO A FRIEND

OR10Z1

olfactory receptor, family 10, subfamily Z, member 1

18 Gene Product Result for
Synonyms: OR1-15
UniProtKB ID: Q8NGY1, Q5VYL0, Q6IFR7
Gene ID:
Human(128368) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(514553) olfactory receptor, family 10, subfamily Z, member 1
dog(488615) olfactory receptor, family 10, subfamily Z, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004478 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004478 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004478 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004478 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004478 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304620 predicted 591
2 SASI_Hs02_00304621 predicted 365
3 SASI_Hs01_00057463 predicted 647
4 SASI_Hs01_00057464 predicted 650
5 SASI_Hs01_00057465 predicted 581
6 SASI_Hs01_00057467 predicted 312
7 SASI_Hs01_00057468 predicted 466
8 SASI_Hs01_00057469 predicted 456
9 SASI_Hs01_00057470 predicted 563
10 SASI_Hs01_00057472 predicted 579
11 SASI_Hs01_00057466 predicted 585
12 SASI_Hs01_00057471 predicted 310
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004478
OR10Z1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 10, subfamily Z, member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004478.1-655s1c1
Sequence:CCGGGCCTACATCTTGGCAGCAATACTCGAGTATTGCTGCCAAGATGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004478.1-72s1c1
Sequence:CCGGGCTCCTTCTCTTTGCCTTGTTCTCGAGAACAAGGCAAAGAGAAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004478.1-728s1c1
Sequence:CCGGCGCACCTTACAGTGGTCATTACTCGAGTAATGACCACTGTAAGGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004478.1-322s1c1
Sequence:CCGGGCCTGTACTAACTGCTTCCTTCTCGAGAAGGAAGCAGTTAGTACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004478.1-85s1c1
Sequence:CCGGGCCTTGTTCCTCTCTCTGTATCTCGAGATACAGAGAGAGGAACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004478
OR10Z1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 10, subfamily Z, member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004478.1-655s1c1
Sequence:CCGGGCCTACATCTTGGCAGCAATACTCGAGTATTGCTGCCAAGATGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004478.1-72s1c1
Sequence:CCGGGCTCCTTCTCTTTGCCTTGTTCTCGAGAACAAGGCAAAGAGAAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004478.1-728s1c1
Sequence:CCGGCGCACCTTACAGTGGTCATTACTCGAGTAATGACCACTGTAAGGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004478.1-322s1c1
Sequence:CCGGGCCTGTACTAACTGCTTCCTTCTCGAGAAGGAAGCAGTTAGTACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004478.1-85s1c1
Sequence:CCGGGCCTTGTTCCTCTCTCTGTATCTCGAGATACAGAGAGAGGAACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004478
OR10Z1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 10, subfamily Z, member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004478.1-655s1c1
Sequence:CCGGGCCTACATCTTGGCAGCAATACTCGAGTATTGCTGCCAAGATGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004478.1-72s1c1
Sequence:CCGGGCTCCTTCTCTTTGCCTTGTTCTCGAGAACAAGGCAAAGAGAAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004478.1-728s1c1
Sequence:CCGGCGCACCTTACAGTGGTCATTACTCGAGTAATGACCACTGTAAGGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004478.1-322s1c1
Sequence:CCGGGCCTGTACTAACTGCTTCCTTCTCGAGAAGGAAGCAGTTAGTACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004478.1-85s1c1
Sequence:CCGGGCCTTGTTCCTCTCTCTGTATCTCGAGATACAGAGAGAGGAACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)