EMAIL THIS PAGE TO A FRIEND

OR11A1

olfactory receptor, family 11, subfamily A, member 1

17 Gene Product Result for
Synonyms: OR11A2 dJ994E9.6 hs6M1-18
Species: Human OR11A1(26531)
UniProtKB ID: Q9GZK7, A2BF33, A6NFQ3, B0S7T2, Q5ST16, Q9GZK8
Gene ID:
Human(26531) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305940 ANTI-OR11A1 (C-TERM) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013937 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013937 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013937 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013937 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231181 predicted 828
2 SASI_Hs01_00231182 predicted 198
3 SASI_Hs01_00231183 predicted 376
4 SASI_Hs01_00231184 predicted 664
5 SASI_Hs01_00231185 predicted 747
6 SASI_Hs01_00231186 predicted 834
7 SASI_Hs01_00231187 predicted 837
8 SASI_Hs01_00231189 predicted 542
9 SASI_Hs01_00231190 predicted 377
10 SASI_Hs02_00344874 predicted 379
11 SASI_Hs01_00231188 predicted 946
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013937
OR11A1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 11, subfamily A, member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013937.2-158s1c1
Sequence:CCGGCCTGAACTGCATTTCTTGTTTCTCGAGAAACAAGAAATGCAGTTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013937.2-826s1c1
Sequence:CCGGCCTAGCTGTAGTGACCACATTCTCGAGAATGTGGTCACTACAGCTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009295    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013937.2-1227s1c1
Sequence:CCGGGCAGGTTTGTTACATAGGTAACTCGAGTTACCTATGTAACAAACCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013937.2-940s1c1
Sequence:CCGGCCCTCTCTTCAATCCTGTGATCTCGAGATCACAGGATTGAAGAGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013937.2-605s1c1
Sequence:CCGGCCCAACCACATTGACCAGTTTCTCGAGAAACTGGTCAATGTGGTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013937.2-1148s21c1
Sequence:CCGGCTCTTCTGCAGTTATACTAAACTCGAGTTTAGTATAACTGCAGAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013937.2-728s21c1
Sequence:CCGGGGACTGATTCTGACATCTTATCTCGAGATAAGATGTCAGAATCAGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013937.2-215s21c1
Sequence:CCGGATAGGGAATATGCTGATTATTCTCGAGAATAATCAGCATATTCCCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357716    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013937.2-1425s21c1
Sequence:CCGGGAGTGAAGACATACGGTATTTCTCGAGAAATACCGTATGTCTTCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013937
OR11A1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 11, subfamily A, member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013937.2-158s1c1
Sequence:CCGGCCTGAACTGCATTTCTTGTTTCTCGAGAAACAAGAAATGCAGTTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013937.2-826s1c1
Sequence:CCGGCCTAGCTGTAGTGACCACATTCTCGAGAATGTGGTCACTACAGCTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009295    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013937.2-1227s1c1
Sequence:CCGGGCAGGTTTGTTACATAGGTAACTCGAGTTACCTATGTAACAAACCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013937.2-940s1c1
Sequence:CCGGCCCTCTCTTCAATCCTGTGATCTCGAGATCACAGGATTGAAGAGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013937.2-605s1c1
Sequence:CCGGCCCAACCACATTGACCAGTTTCTCGAGAAACTGGTCAATGTGGTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013937.2-1148s21c1
Sequence:CCGGCTCTTCTGCAGTTATACTAAACTCGAGTTTAGTATAACTGCAGAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013937.2-728s21c1
Sequence:CCGGGGACTGATTCTGACATCTTATCTCGAGATAAGATGTCAGAATCAGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013937.2-215s21c1
Sequence:CCGGATAGGGAATATGCTGATTATTCTCGAGAATAATCAGCATATTCCCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357716    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013937.2-1425s21c1
Sequence:CCGGGAGTGAAGACATACGGTATTTCTCGAGAAATACCGTATGTCTTCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013937
OR11A1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 11, subfamily A, member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013937.2-158s1c1
Sequence:CCGGCCTGAACTGCATTTCTTGTTTCTCGAGAAACAAGAAATGCAGTTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013937.2-826s1c1
Sequence:CCGGCCTAGCTGTAGTGACCACATTCTCGAGAATGTGGTCACTACAGCTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009295    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013937.2-1227s1c1
Sequence:CCGGGCAGGTTTGTTACATAGGTAACTCGAGTTACCTATGTAACAAACCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013937.2-940s1c1
Sequence:CCGGCCCTCTCTTCAATCCTGTGATCTCGAGATCACAGGATTGAAGAGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013937.2-605s1c1
Sequence:CCGGCCCAACCACATTGACCAGTTTCTCGAGAAACTGGTCAATGTGGTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357786    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013937.2-1148s21c1
Sequence:CCGGCTCTTCTGCAGTTATACTAAACTCGAGTTTAGTATAACTGCAGAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013937.2-728s21c1
Sequence:CCGGGGACTGATTCTGACATCTTATCTCGAGATAAGATGTCAGAATCAGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013937.2-215s21c1
Sequence:CCGGATAGGGAATATGCTGATTATTCTCGAGAATAATCAGCATATTCCCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357716    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013937.2-1425s21c1
Sequence:CCGGGAGTGAAGACATACGGTATTTCTCGAGAAATACCGTATGTCTTCACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)