EMAIL THIS PAGE TO A FRIEND

OR11G2

olfactory receptor, family 11, subfamily G, member 2

15 Gene Product Result for
Synonyms: OR14-34
UniProtKB ID: Q8NGC1, Q6IF09, Q96R33
Gene ID:
Human(390439) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(783918) olfactory receptor, family 11, subfamily G, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501712 Anti-OR11G2 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372506 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372506 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372506 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041901 MISSION® esiRNA esiRNA human OR11G2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005503 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145483 predicted 312
2 SASI_Hs01_00145484 predicted 685
3 SASI_Hs01_00145485 predicted 732
4 SASI_Hs01_00145486 predicted 515
5 SASI_Hs01_00145487 predicted 617
6 SASI_Hs01_00145488 predicted 612
7 SASI_Hs01_00145489 predicted 681
8 SASI_Hs01_00145490 predicted 461
9 SASI_Hs01_00145491 predicted 215
10 SASI_Hs02_00304970 predicted 497
11 SASI_Hs01_00145492 predicted 656
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372506
OR11G2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 11, subfamily G, member 2
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000204309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372506.1-988s1c1
Sequence:CCGGCCTATCGTCAACATCTCCCAACTCGAGTTGGGAGATGTTGACGATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372506.1-978s1c1
Sequence:CCGGGTTCTTGATTCCTATCGTCAACTCGAGTTGACGATAGGAATCAAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372506.1-1090s1c1
Sequence:CCGGCCTGTGATAGAGCTTGTCTTTCTCGAGAAAGACAAGCTCTATCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372506
OR11G2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 11, subfamily G, member 2
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000204309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372506.1-988s1c1
Sequence:CCGGCCTATCGTCAACATCTCCCAACTCGAGTTGGGAGATGTTGACGATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372506.1-978s1c1
Sequence:CCGGGTTCTTGATTCCTATCGTCAACTCGAGTTGACGATAGGAATCAAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372506.1-1090s1c1
Sequence:CCGGCCTGTGATAGAGCTTGTCTTTCTCGAGAAAGACAAGCTCTATCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372506
OR11G2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 11, subfamily G, member 2
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000204309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372506.1-988s1c1
Sequence:CCGGCCTATCGTCAACATCTCCCAACTCGAGTTGGGAGATGTTGACGATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372506.1-978s1c1
Sequence:CCGGGTTCTTGATTCCTATCGTCAACTCGAGTTGACGATAGGAATCAAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372506.1-1090s1c1
Sequence:CCGGCCTGTGATAGAGCTTGTCTTTCTCGAGAAAGACAAGCTCTATCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)