EMAIL THIS PAGE TO A FRIEND

OR11H12

olfactory receptor, family 11, subfamily H, member 12

13 Gene Product Result for
Species: Human OR11H12(440153)
UniProtKB ID: B2RN74
Gene ID:
Human(440153) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101687 Anti-OR11H12 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013354 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013354 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013354 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013354 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206344 predicted 642
2 SASI_Hs01_00206345 predicted 741
3 SASI_Hs01_00206346 predicted 594
4 SASI_Hs01_00206347 predicted 685
5 SASI_Hs01_00206348 predicted 707
6 SASI_Hs01_00206349 predicted 678
7 SASI_Hs01_00206350 predicted 712
8 SASI_Hs01_00206351 predicted 588
9 SASI_Hs01_00206352 predicted 643
10 SASI_Hs01_00206353 predicted 635
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013354
OR11H12 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 11, subfamily H, member 12
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000160518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013354.1-595s1c1
Sequence:CCGGCGATTTGCATTGGATTGTGTTCTCGAGAACACAATCCAATGCAAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013354.1-368s1c1
Sequence:CCGGGTACATCAGAATGCTTGCTTTCTCGAGAAAGCAAGCATTCTGATGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013354.1-108s1c1
Sequence:CCGGGACAATTCAGATCTTCCTCTTCTCGAGAAGAGGAAGATCTGAATTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013354.1-708s1c1
Sequence:CCGGCCTGAAAGCTGTGTTGGGTATCTCGAGATACCCAACACAGCTTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013354.1-781s1c1
Sequence:CCGGGCTGTGGTATCACTGTGCTATCTCGAGATAGCACAGTGATACCACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013354.1-92s1c1
Sequence:CCGGGTTTCACTTGTGAGTGGACAACTCGAGTTGTCCACTCACAAGTGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013354.1-556s1c1
Sequence:CCGGCCAAACATTATTGACCATGTTCTCGAGAACATGGTCAATAATGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013354.1-292s1c1
Sequence:CCGGGTCAACTTCCTTTCAGAGAAACTCGAGTTTCTCTGAAAGGAAGTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013354.1-48s1c1
Sequence:CCGGGCCAAATTCCAGCTTTGCTTTCTCGAGAAAGCAAAGCTGGAATTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013354
OR11H12 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 11, subfamily H, member 12
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000160518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013354.1-595s1c1
Sequence:CCGGCGATTTGCATTGGATTGTGTTCTCGAGAACACAATCCAATGCAAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013354.1-368s1c1
Sequence:CCGGGTACATCAGAATGCTTGCTTTCTCGAGAAAGCAAGCATTCTGATGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013354.1-108s1c1
Sequence:CCGGGACAATTCAGATCTTCCTCTTCTCGAGAAGAGGAAGATCTGAATTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013354.1-708s1c1
Sequence:CCGGCCTGAAAGCTGTGTTGGGTATCTCGAGATACCCAACACAGCTTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013354.1-781s1c1
Sequence:CCGGGCTGTGGTATCACTGTGCTATCTCGAGATAGCACAGTGATACCACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013354.1-92s1c1
Sequence:CCGGGTTTCACTTGTGAGTGGACAACTCGAGTTGTCCACTCACAAGTGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013354.1-556s1c1
Sequence:CCGGCCAAACATTATTGACCATGTTCTCGAGAACATGGTCAATAATGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013354.1-292s1c1
Sequence:CCGGGTCAACTTCCTTTCAGAGAAACTCGAGTTTCTCTGAAAGGAAGTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013354.1-48s1c1
Sequence:CCGGGCCAAATTCCAGCTTTGCTTTCTCGAGAAAGCAAAGCTGGAATTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013354
OR11H12 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 11, subfamily H, member 12
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000160518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013354.1-595s1c1
Sequence:CCGGCGATTTGCATTGGATTGTGTTCTCGAGAACACAATCCAATGCAAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013354.1-368s1c1
Sequence:CCGGGTACATCAGAATGCTTGCTTTCTCGAGAAAGCAAGCATTCTGATGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013354.1-108s1c1
Sequence:CCGGGACAATTCAGATCTTCCTCTTCTCGAGAAGAGGAAGATCTGAATTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013354.1-708s1c1
Sequence:CCGGCCTGAAAGCTGTGTTGGGTATCTCGAGATACCCAACACAGCTTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013354.1-781s1c1
Sequence:CCGGGCTGTGGTATCACTGTGCTATCTCGAGATAGCACAGTGATACCACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013354.1-92s1c1
Sequence:CCGGGTTTCACTTGTGAGTGGACAACTCGAGTTGTCCACTCACAAGTGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013354.1-556s1c1
Sequence:CCGGCCAAACATTATTGACCATGTTCTCGAGAACATGGTCAATAATGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013354.1-292s1c1
Sequence:CCGGGTCAACTTCCTTTCAGAGAAACTCGAGTTTCTCTGAAAGGAAGTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013354.1-48s1c1
Sequence:CCGGGCCAAATTCCAGCTTTGCTTTCTCGAGAAAGCAAAGCTGGAATTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)