EMAIL THIS PAGE TO A FRIEND

OR11H1

olfactory receptor, family 11, subfamily H, member 1

16 Gene Product Result for
Synonyms: OR22-1
Species: Human OR11H1(81061)
UniProtKB ID: Q8NG94, Q6IEX0, Q96R32
Gene ID:
Human(81061) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005239 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005239 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005239 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU224811 MISSION® esiRNA esiRNA targeting human OR11H1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005239 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005239 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099281 predicted 642
2 SASI_Hs01_00099282 predicted 743
3 SASI_Hs01_00099283 predicted 710
4 SASI_Hs01_00099284 predicted 686
5 SASI_Hs01_00099285 predicted 587
6 SASI_Hs01_00099286 predicted 678
7 SASI_Hs01_00099287 predicted 585
8 SASI_Hs01_00099288 predicted 645
9 SASI_Hs01_00099289 predicted 639
10 SASI_Hs01_00099290 predicted 663
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005239
OR11H1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 11, subfamily H, member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005239.1-442s1c1
Sequence:CCGGCCTAATATCATGACTGGGCATCTCGAGATGCCCAGTCATGATATTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005239.1-427s1c1
Sequence:CCGGCGTCCCTTGCTCTATCCTAATCTCGAGATTAGGATAGAGCAAGGGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005239.1-143s1c1
Sequence:CCGGCAACATATGCACTGACTATAACTCGAGTTATAGTCAGTGCATATGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005239.1-708s1c1
Sequence:CCGGCCTGAAAGCTATGTTGGGTATCTCGAGATACCCAACATAGCTTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005239.1-151s1c1
Sequence:CCGGGCACTGACTATAACAGGGAATCTCGAGATTCCCTGTTATAGTCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005239
OR11H1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 11, subfamily H, member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005239.1-442s1c1
Sequence:CCGGCCTAATATCATGACTGGGCATCTCGAGATGCCCAGTCATGATATTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005239.1-427s1c1
Sequence:CCGGCGTCCCTTGCTCTATCCTAATCTCGAGATTAGGATAGAGCAAGGGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005239.1-143s1c1
Sequence:CCGGCAACATATGCACTGACTATAACTCGAGTTATAGTCAGTGCATATGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005239.1-708s1c1
Sequence:CCGGCCTGAAAGCTATGTTGGGTATCTCGAGATACCCAACATAGCTTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005239.1-151s1c1
Sequence:CCGGGCACTGACTATAACAGGGAATCTCGAGATTCCCTGTTATAGTCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005239
OR11H1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 11, subfamily H, member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005239.1-442s1c1
Sequence:CCGGCCTAATATCATGACTGGGCATCTCGAGATGCCCAGTCATGATATTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005239.1-427s1c1
Sequence:CCGGCGTCCCTTGCTCTATCCTAATCTCGAGATTAGGATAGAGCAAGGGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005239.1-143s1c1
Sequence:CCGGCAACATATGCACTGACTATAACTCGAGTTATAGTCAGTGCATATGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005239.1-708s1c1
Sequence:CCGGCCTGAAAGCTATGTTGGGTATCTCGAGATACCCAACATAGCTTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005239.1-151s1c1
Sequence:CCGGGCACTGACTATAACAGGGAATCTCGAGATTCCCTGTTATAGTCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)