EMAIL THIS PAGE TO A FRIEND

OR11L1

olfactory receptor, family 11, subfamily L, member 1

16 Gene Product Result for
UniProtKB ID: Q8NGX0
Gene ID:
Human(391189) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(783250) olfactory receptor, family 11, subfamily L, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303932 ANTI-OR11L1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4501722 Anti-OR11L1 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372820 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372820 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372820 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002211 MISSION® esiRNA esiRNA targeting human OR11L1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001959 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001959 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233796 predicted 497
2 SASI_Hs01_00233797 predicted 503
3 SASI_Hs01_00233798 predicted 294
4 SASI_Hs01_00233799 predicted 549
5 SASI_Hs01_00233801 predicted 600
6 SASI_Hs01_00233802 predicted 541
7 SASI_Hs01_00233803 predicted 563
8 SASI_Hs01_00233804 predicted 509
9 SASI_Hs01_00233805 predicted 508
10 SASI_Hs02_00304030 predicted 678
11 SASI_Hs01_00233800 predicted 566
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372820
OR11L1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 11, subfamily L, member 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372820.2-802s1c1
Sequence:CCGGCCTGAAATCAACAAGATCATTCTCGAGAATGATCTTGTTGATTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372820.2-510s1c1
Sequence:CCGGGCGCAATCAGATTAACCATTTCTCGAGAAATGGTTAATCTGATTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372820.2-1015s1c1
Sequence:CCGGCCACTGACTTTGAACTGGAATCTCGAGATTCCAGTTCAAAGTCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372820.2-1704s1c1
Sequence:CCGGCCTCAACAAGATCCTCTTTATCTCGAGATAAAGAGGATCTTGTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372820.2-801s1c1
Sequence:CCGGGCCTGAAATCAACAAGATCATCTCGAGATGATCTTGTTGATTTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372820.2-1115s1c1
Sequence:CCGGCCATAACCTGTGCTGTTCCTACTCGAGTAGGAACAGCACAGGTTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372820
OR11L1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 11, subfamily L, member 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372820.2-802s1c1
Sequence:CCGGCCTGAAATCAACAAGATCATTCTCGAGAATGATCTTGTTGATTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372820.2-510s1c1
Sequence:CCGGGCGCAATCAGATTAACCATTTCTCGAGAAATGGTTAATCTGATTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372820.2-1015s1c1
Sequence:CCGGCCACTGACTTTGAACTGGAATCTCGAGATTCCAGTTCAAAGTCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372820.2-1704s1c1
Sequence:CCGGCCTCAACAAGATCCTCTTTATCTCGAGATAAAGAGGATCTTGTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372820.2-801s1c1
Sequence:CCGGGCCTGAAATCAACAAGATCATCTCGAGATGATCTTGTTGATTTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372820.2-1115s1c1
Sequence:CCGGCCATAACCTGTGCTGTTCCTACTCGAGTAGGAACAGCACAGGTTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372820
OR11L1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 11, subfamily L, member 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372820.2-802s1c1
Sequence:CCGGCCTGAAATCAACAAGATCATTCTCGAGAATGATCTTGTTGATTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372820.2-510s1c1
Sequence:CCGGGCGCAATCAGATTAACCATTTCTCGAGAAATGGTTAATCTGATTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187423    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372820.2-1015s1c1
Sequence:CCGGCCACTGACTTTGAACTGGAATCTCGAGATTCCAGTTCAAAGTCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372820.2-1704s1c1
Sequence:CCGGCCTCAACAAGATCCTCTTTATCTCGAGATAAAGAGGATCTTGTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186574    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372820.2-801s1c1
Sequence:CCGGGCCTGAAATCAACAAGATCATCTCGAGATGATCTTGTTGATTTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_372820.2-1115s1c1
Sequence:CCGGCCATAACCTGTGCTGTTCCTACTCGAGTAGGAACAGCACAGGTTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)