EMAIL THIS PAGE TO A FRIEND

OR12D2

olfactory receptor, family 12, subfamily D, member 2

19 Gene Product Result for
Synonyms: DJ994E9.8 HS6M1-20
UniProtKB ID: P58182, B0S862, Q5SUN9, Q6IET9
Gene ID:
Human(26529) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
chicken(427485) olfactory receptor, family 12, subfamily D, member 2
cow(510775) olfactory receptor, family 12, subfamily D, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013936 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013936 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013936 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110971 MISSION® esiRNA esiRNA human OR12D2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013936 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013936 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344871 predicted 776
2 SASI_Hs02_00344872 predicted 247
3 SASI_Hs01_00153789 predicted 484
4 SASI_Hs01_00153790 predicted 325
5 SASI_Hs02_00344873 predicted 207
6 SASI_Hs01_00153791 predicted 699
7 SASI_Hs01_00153792 predicted 737
8 SASI_Hs01_00153793 predicted 600
9 SASI_Hs01_00153794 predicted 528
10 SASI_Hs01_00153795 predicted 293
11 SASI_Hs01_00153788 predicted 397
12 SASI_Hs01_00153796 predicted 377
13 SASI_Hs01_00153797 predicted 437
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013936
OR12D2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 12, subfamily D, member 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013936.3-785s21c1
Sequence:CCGGTCCCACTTCATGGTAGTTATTCTCGAGAATAACTACCATGAAGTGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013936.3-565s21c1
Sequence:CCGGTTCCAACCGTATCCATCATTTCTCGAGAAATGATGGATACGGTTGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013936.3-692s21c1
Sequence:CCGGCTGACACTTCTCTCCTATTTCCTCGAGGAAATAGGAGAGAAGTGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013936.2-427s1c1
Sequence:CCGGGCCATCACAATCTGGGTCATTCTCGAGAATGACCCAGATTGTGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013936.2-633s1c1
Sequence:CCGGGACACTTCTCTCCTATTTCTACTCGAGTAGAAATAGGAGAGAAGTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013936.2-159s1c1
Sequence:CCGGCCATTCCCTTATGTATTTCTTCTCGAGAAGAAATACATAAGGGAATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013936.2-474s1c1
Sequence:CCGGCGTAATGACTTCTCGCTTGAACTCGAGTTCAAGCGAGAAGTCATTACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013936.2-722s1c1
Sequence:CCGGCCTCCCACTTCATGGTAGTTACTCGAGTAACTACCATGAAGTGGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013936
OR12D2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 12, subfamily D, member 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013936.3-785s21c1
Sequence:CCGGTCCCACTTCATGGTAGTTATTCTCGAGAATAACTACCATGAAGTGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013936.3-565s21c1
Sequence:CCGGTTCCAACCGTATCCATCATTTCTCGAGAAATGATGGATACGGTTGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013936.3-692s21c1
Sequence:CCGGCTGACACTTCTCTCCTATTTCCTCGAGGAAATAGGAGAGAAGTGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013936.2-427s1c1
Sequence:CCGGGCCATCACAATCTGGGTCATTCTCGAGAATGACCCAGATTGTGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013936.2-633s1c1
Sequence:CCGGGACACTTCTCTCCTATTTCTACTCGAGTAGAAATAGGAGAGAAGTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013936.2-159s1c1
Sequence:CCGGCCATTCCCTTATGTATTTCTTCTCGAGAAGAAATACATAAGGGAATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013936.2-474s1c1
Sequence:CCGGCGTAATGACTTCTCGCTTGAACTCGAGTTCAAGCGAGAAGTCATTACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013936.2-722s1c1
Sequence:CCGGCCTCCCACTTCATGGTAGTTACTCGAGTAACTACCATGAAGTGGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013936
OR12D2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 12, subfamily D, member 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013936.3-785s21c1
Sequence:CCGGTCCCACTTCATGGTAGTTATTCTCGAGAATAACTACCATGAAGTGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013936.3-565s21c1
Sequence:CCGGTTCCAACCGTATCCATCATTTCTCGAGAAATGATGGATACGGTTGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013936.3-692s21c1
Sequence:CCGGCTGACACTTCTCTCCTATTTCCTCGAGGAAATAGGAGAGAAGTGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013936.2-427s1c1
Sequence:CCGGGCCATCACAATCTGGGTCATTCTCGAGAATGACCCAGATTGTGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013936.2-633s1c1
Sequence:CCGGGACACTTCTCTCCTATTTCTACTCGAGTAGAAATAGGAGAGAAGTGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013936.2-159s1c1
Sequence:CCGGCCATTCCCTTATGTATTTCTTCTCGAGAAGAAATACATAAGGGAATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013936.2-474s1c1
Sequence:CCGGCGTAATGACTTCTCGCTTGAACTCGAGTTCAAGCGAGAAGTCATTACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013936.2-722s1c1
Sequence:CCGGCCTCCCACTTCATGGTAGTTACTCGAGTAACTACCATGAAGTGGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)