EMAIL THIS PAGE TO A FRIEND

OR13C4

olfactory receptor, family 13, subfamily C, member 4

14 Gene Product Result for
Synonyms: HSHTPCRX17 HTPCRX17 OR2K1 OR37F OR9-7
Species: Human OR13C4(138804)
UniProtKB ID: Q8NGS5, Q6IF51, Q96R41
Gene ID:
Human(138804) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1304195 ANTI-OR13C4 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4500459 Anti-OR13C4 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_071098 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_071098 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_071098 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001919 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001919 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060354 predicted 532
2 SASI_Hs01_00060355 predicted 417
3 SASI_Hs01_00060356 predicted 562
4 SASI_Hs01_00060357 predicted 528
5 SASI_Hs01_00060358 predicted 583
6 SASI_Hs01_00060359 predicted 489
7 SASI_Hs01_00060360 predicted 590
8 SASI_Hs01_00060361 predicted 398
9 SASI_Hs01_00060362 predicted 595
10 SASI_Hs01_00060363 predicted 408
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_071098
OR13C4 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 13, subfamily C, member 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071098.2-498s1c2
Sequence:CCGGGCCTTTCTGTGGGAACAATATCTCGAGATATTGTTCCCACAGAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071098.2-106s1c1
Sequence:CCGGGTAGTGATTCTAATTGGCAATCTCGAGATTGCCAATTAGAATCACTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071098.2-191s1c1
Sequence:CCGGGCAACCTCTCTTTCCTGGATACTCGAGTATCCAGGAAAGAGAGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071098.2-458s1c1
Sequence:CCGGGAATCAATTCAACTGTGCAAACTCGAGTTTGCACAGTTGAATTGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071098.2-536s1c1
Sequence:CCGGGCGAGATCTTAGCTGTCCTAACTCGAGTTAGGACAGCTAAGATCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_071098
OR13C4 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 13, subfamily C, member 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071098.2-498s1c2
Sequence:CCGGGCCTTTCTGTGGGAACAATATCTCGAGATATTGTTCCCACAGAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071098.2-106s1c1
Sequence:CCGGGTAGTGATTCTAATTGGCAATCTCGAGATTGCCAATTAGAATCACTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071098.2-191s1c1
Sequence:CCGGGCAACCTCTCTTTCCTGGATACTCGAGTATCCAGGAAAGAGAGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071098.2-458s1c1
Sequence:CCGGGAATCAATTCAACTGTGCAAACTCGAGTTTGCACAGTTGAATTGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071098.2-536s1c1
Sequence:CCGGGCGAGATCTTAGCTGTCCTAACTCGAGTTAGGACAGCTAAGATCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_071098
OR13C4 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 13, subfamily C, member 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071098.2-498s1c2
Sequence:CCGGGCCTTTCTGTGGGAACAATATCTCGAGATATTGTTCCCACAGAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071098.2-106s1c1
Sequence:CCGGGTAGTGATTCTAATTGGCAATCTCGAGATTGCCAATTAGAATCACTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071098.2-191s1c1
Sequence:CCGGGCAACCTCTCTTTCCTGGATACTCGAGTATCCAGGAAAGAGAGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071098.2-458s1c1
Sequence:CCGGGAATCAATTCAACTGTGCAAACTCGAGTTTGCACAGTTGAATTGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071098.2-536s1c1
Sequence:CCGGGCGAGATCTTAGCTGTCCTAACTCGAGTTAGGACAGCTAAGATCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)