EMAIL THIS PAGE TO A FRIEND

OR13C8

olfactory receptor, family 13, subfamily C, member 8

15 Gene Product Result for
Synonyms: OR37H OR9-10
UniProtKB ID: Q8NGS7, Q5VVG0, Q96R44
Gene ID:
Human(138802) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(789782) olfactory receptor, family 13, subfamily C, member 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_071096 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_071096 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_071096 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004483 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012301 predicted 492
2 SASI_Hs01_00012302 predicted 645
3 SASI_Hs02_00304627 predicted 675
4 SASI_Hs01_00012304 predicted 613
5 SASI_Hs01_00012305 predicted 284
6 SASI_Hs01_00012306 predicted 282
7 SASI_Hs01_00012307 predicted 486
8 SASI_Hs01_00012308 predicted 211
9 SASI_Hs01_00012309 predicted 601
10 SASI_Hs01_00012310 predicted 602
11 SASI_Hs01_00012303 predicted 573
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_071096
OR13C8 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 13, subfamily C, member 8
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000186159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071096.3-605s1c1
Sequence:CCGGCGAATCTGATTGTTCTGGTTACTCGAGTAACCAGAACAATCAGATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071096.3-668s1c1
Sequence:CCGGCCACTATTCTGAGGATTCCTTCTCGAGAAGGAATCCTCAGAATAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071096.3-117s1c1
Sequence:CCGGGCTTGGAAATGGAGTCCTTATCTCGAGATAAGGACTCCATTTCCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071096.3-492s1c1
Sequence:CCGGGCAGTTACCATTCTGTGCTAACTCGAGTTAGCACAGAATGGTAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_071096
OR13C8 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 13, subfamily C, member 8
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000186159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071096.3-605s1c1
Sequence:CCGGCGAATCTGATTGTTCTGGTTACTCGAGTAACCAGAACAATCAGATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071096.3-668s1c1
Sequence:CCGGCCACTATTCTGAGGATTCCTTCTCGAGAAGGAATCCTCAGAATAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071096.3-117s1c1
Sequence:CCGGGCTTGGAAATGGAGTCCTTATCTCGAGATAAGGACTCCATTTCCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071096.3-492s1c1
Sequence:CCGGGCAGTTACCATTCTGTGCTAACTCGAGTTAGCACAGAATGGTAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_071096
OR13C8 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 13, subfamily C, member 8
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000186159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071096.3-605s1c1
Sequence:CCGGCGAATCTGATTGTTCTGGTTACTCGAGTAACCAGAACAATCAGATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071096.3-668s1c1
Sequence:CCGGCCACTATTCTGAGGATTCCTTCTCGAGAAGGAATCCTCAGAATAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071096.3-117s1c1
Sequence:CCGGGCTTGGAAATGGAGTCCTTATCTCGAGATAAGGACTCCATTTCCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071096.3-492s1c1
Sequence:CCGGGCAGTTACCATTCTGTGCTAACTCGAGTTAGCACAGAATGGTAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)