EMAIL THIS PAGE TO A FRIEND

OR13F1

olfactory receptor, family 13, subfamily F, member 1

16 Gene Product Result for
Synonyms: OR9-6
UniProtKB ID: Q8NGS4, Q6IF50
Gene ID:
Human(138805) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(789938) olfactory receptor, family 13, subfamily F, member 1
cow(786765) olfactory receptor, family 13, subfamily F, member 1
dog(481644) cOR13F4 olfactory receptor family 13 subfamily F-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_071099 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_071099 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_071099 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004485 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004485 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237106 predicted 492
2 SASI_Hs01_00237108 predicted 491
3 SASI_Hs01_00237109 predicted 720
4 SASI_Hs02_00304631 predicted 461
5 SASI_Hs01_00237110 predicted 578
6 SASI_Hs01_00237111 predicted 629
7 SASI_Hs01_00237112 predicted 627
8 SASI_Hs01_00237113 predicted 647
9 SASI_Hs01_00237115 predicted 390
10 SASI_Hs02_00304632 predicted 228
11 SASI_Hs01_00237107 predicted 598
12 SASI_Hs01_00237114 predicted 538
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_071099
OR13F1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 13, subfamily F, member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000187117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071099.5-584s1c1
Sequence:CCGGCCATGCCAATGCTACTCATTTCTCGAGAAATGAGTAGCATTGGCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071099.5-583s1c1
Sequence:CCGGCCCATGCCAATGCTACTCATTCTCGAGAATGAGTAGCATTGGCATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071099.5-130s1c1
Sequence:CCGGCCTGAGTATGTTCCTGAAGAACTCGAGTTCTTCAGGAACATACTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071099.5-476s1c1
Sequence:CCGGGCATCATCAATCATTTCACTTCTCGAGAAGTGAAATGATTGATGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071099.5-104s1c1
Sequence:CCGGCCAAGGTACTAGCCTTAATAACTCGAGTTATTAAGGCTAGTACCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_071099
OR13F1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 13, subfamily F, member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000187117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071099.5-584s1c1
Sequence:CCGGCCATGCCAATGCTACTCATTTCTCGAGAAATGAGTAGCATTGGCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071099.5-583s1c1
Sequence:CCGGCCCATGCCAATGCTACTCATTCTCGAGAATGAGTAGCATTGGCATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071099.5-130s1c1
Sequence:CCGGCCTGAGTATGTTCCTGAAGAACTCGAGTTCTTCAGGAACATACTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071099.5-476s1c1
Sequence:CCGGGCATCATCAATCATTTCACTTCTCGAGAAGTGAAATGATTGATGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071099.5-104s1c1
Sequence:CCGGCCAAGGTACTAGCCTTAATAACTCGAGTTATTAAGGCTAGTACCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_071099
OR13F1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 13, subfamily F, member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000187117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071099.5-584s1c1
Sequence:CCGGCCATGCCAATGCTACTCATTTCTCGAGAAATGAGTAGCATTGGCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071099.5-583s1c1
Sequence:CCGGCCCATGCCAATGCTACTCATTCTCGAGAATGAGTAGCATTGGCATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071099.5-130s1c1
Sequence:CCGGCCTGAGTATGTTCCTGAAGAACTCGAGTTCTTCAGGAACATACTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071099.5-476s1c1
Sequence:CCGGGCATCATCAATCATTTCACTTCTCGAGAAGTGAAATGATTGATGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_071099.5-104s1c1
Sequence:CCGGCCAAGGTACTAGCCTTAATAACTCGAGTTATTAAGGCTAGTACCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)