EMAIL THIS PAGE TO A FRIEND

OR13H1

olfactory receptor, family 13, subfamily H, member 1

14 Gene Product Result for
Synonyms: ORX1
UniProtKB ID: Q8NG92, B2RNQ3, Q6IET8, Q96R12
Gene ID:
Human(347468) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(786155) olfactory receptor, family 13, subfamily H, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303699 ANTI-O13H1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing
SAB4501518 Anti-OR13H1 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_293366 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_293366 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_293366 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004486 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004486 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080785 predicted 651
2 SASI_Hs01_00080786 predicted 525
3 SASI_Hs01_00080787 predicted 383
4 SASI_Hs01_00080788 predicted 283
5 SASI_Hs01_00080789 predicted 349
6 SASI_Hs01_00080790 predicted 572
7 SASI_Hs01_00080791 predicted 617
8 SASI_Hs01_00080792 predicted 473
9 SASI_Hs01_00080793 predicted 238
10 SASI_Hs01_00080794 predicted 639
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_293366
OR13H1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 13, subfamily H, member 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000204569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293366.3-545s1c1
Sequence:CCGGCCCTCATTAAGCTGACCTGTTCTCGAGAACAGGTCAGCTTAATGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293366.3-391s1c1
Sequence:CCGGCGTTATTCAGTGGTTATGAATCTCGAGATTCATAACCACTGAATAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293366.3-656s1c1
Sequence:CCGGGAATTGCTATGGCTATCATAACTCGAGTTATGATAGCCATAGCAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293366.3-47s1c1
Sequence:CCGGGCATTTCTAACTATCCTCAATCTCGAGATTGAGGATAGTTAGAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_293366
OR13H1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 13, subfamily H, member 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000204569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293366.3-545s1c1
Sequence:CCGGCCCTCATTAAGCTGACCTGTTCTCGAGAACAGGTCAGCTTAATGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293366.3-391s1c1
Sequence:CCGGCGTTATTCAGTGGTTATGAATCTCGAGATTCATAACCACTGAATAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293366.3-656s1c1
Sequence:CCGGGAATTGCTATGGCTATCATAACTCGAGTTATGATAGCCATAGCAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293366.3-47s1c1
Sequence:CCGGGCATTTCTAACTATCCTCAATCTCGAGATTGAGGATAGTTAGAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_293366
OR13H1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 13, subfamily H, member 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000204569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293366.3-545s1c1
Sequence:CCGGCCCTCATTAAGCTGACCTGTTCTCGAGAACAGGTCAGCTTAATGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293366.3-391s1c1
Sequence:CCGGCGTTATTCAGTGGTTATGAATCTCGAGATTCATAACCACTGAATAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293366.3-656s1c1
Sequence:CCGGGAATTGCTATGGCTATCATAACTCGAGTTATGATAGCCATAGCAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_293366.3-47s1c1
Sequence:CCGGGCATTTCTAACTATCCTCAATCTCGAGATTGAGGATAGTTAGAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)