EMAIL THIS PAGE TO A FRIEND

OR14C36

olfactory receptor, family 14, subfamily C, member 36

17 Gene Product Result for
Synonyms: OR5BF1
Species: Human OR14C36(127066)
UniProtKB ID: Q8NHC7, Q6IEZ6
Gene ID:
Human(127066) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302194 ANTI-OR14C36 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_060307 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_060307 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_060307 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001918 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041157 predicted 613
2 SASI_Hs01_00041159 predicted 682
3 SASI_Hs01_00041160 predicted 573
4 SASI_Hs01_00041161 predicted 610
5 SASI_Hs01_00041162 predicted 606
6 SASI_Hs01_00041163 predicted 574
7 SASI_Hs01_00041165 predicted 657
8 SASI_Hs01_00041166 predicted 568
9 SASI_Hs02_00303993 predicted 613
10 SASI_Hs02_00303994 predicted 576
11 SASI_Hs01_00041158 predicted 638
12 SASI_Hs01_00041164 predicted 640
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_060307
OR14C36 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 14, subfamily C, member 36
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060307.1-618s1c2
Sequence:CCGGCGGCTGTTTCATCTTTATCATCTCGAGATGATAAAGATGAAACAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060307.1-747s1c1
Sequence:CCGGCCTCAGTTCATGCTCTTCTGTCTCGAGACAGAAGAGCATGAACTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060307.1-79s1c1
Sequence:CCGGGCATCCTTCTTTATGTTGTATCTCGAGATACAACATAAAGAAGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060307.1-504s1c1
Sequence:CCGGGTCCAACGTTATTCATCAATTCTCGAGAATTGATGAATAACGTTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060307.1-639s1c1
Sequence:CCGGCAGGTCTTACATTCACATCTTCTCGAGAAGATGTGAATGTAAGACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060307.1-180s1c1
Sequence:CCGGCCTCAGGAATCTGTCTATCTTCTCGAGAAGATAGACAGATTCCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_060307
OR14C36 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 14, subfamily C, member 36
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060307.1-618s1c2
Sequence:CCGGCGGCTGTTTCATCTTTATCATCTCGAGATGATAAAGATGAAACAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060307.1-747s1c1
Sequence:CCGGCCTCAGTTCATGCTCTTCTGTCTCGAGACAGAAGAGCATGAACTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060307.1-79s1c1
Sequence:CCGGGCATCCTTCTTTATGTTGTATCTCGAGATACAACATAAAGAAGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060307.1-504s1c1
Sequence:CCGGGTCCAACGTTATTCATCAATTCTCGAGAATTGATGAATAACGTTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060307.1-639s1c1
Sequence:CCGGCAGGTCTTACATTCACATCTTCTCGAGAAGATGTGAATGTAAGACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060307.1-180s1c1
Sequence:CCGGCCTCAGGAATCTGTCTATCTTCTCGAGAAGATAGACAGATTCCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_060307
OR14C36 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 14, subfamily C, member 36
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060307.1-618s1c2
Sequence:CCGGCGGCTGTTTCATCTTTATCATCTCGAGATGATAAAGATGAAACAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188557    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060307.1-747s1c1
Sequence:CCGGCCTCAGTTCATGCTCTTCTGTCTCGAGACAGAAGAGCATGAACTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185698    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060307.1-79s1c1
Sequence:CCGGGCATCCTTCTTTATGTTGTATCTCGAGATACAACATAAAGAAGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060307.1-504s1c1
Sequence:CCGGGTCCAACGTTATTCATCAATTCTCGAGAATTGATGAATAACGTTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060307.1-639s1c1
Sequence:CCGGCAGGTCTTACATTCACATCTTCTCGAGAAGATGTGAATGTAAGACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187116    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_060307.1-180s1c1
Sequence:CCGGCCTCAGGAATCTGTCTATCTTCTCGAGAAGATAGACAGATTCCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)