EMAIL THIS PAGE TO A FRIEND

OR14I1

olfactory receptor, family 14, subfamily I, member 1

14 Gene Product Result for
Synonyms: OR5BU1 OR5BU1P
Species: Human OR14I1(401994)
UniProtKB ID: A6ND48
Gene ID:
Human(401994) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_377645 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_377645 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_377645 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU053271 MISSION® esiRNA esiRNA human OR14I1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004734 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004734 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060764 predicted 216
2 SASI_Hs01_00060765 predicted 403
3 SASI_Hs01_00060767 predicted 263
4 SASI_Hs02_00304692 predicted 635
5 SASI_Hs01_00060768 predicted 531
6 SASI_Hs01_00060769 predicted 279
7 SASI_Hs01_00060770 predicted 468
8 SASI_Hs01_00060771 predicted 388
9 SASI_Hs01_00060772 predicted 422
10 SASI_Hs01_00060773 predicted 489
11 SASI_Hs01_00060766 predicted 608
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_377645
OR14I1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 14, subfamily I, member 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000189423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377645.1-120s1c1
Sequence:CCGGCCTGCTCATCATTGCAGTCATCTCGAGATGACTGCAATGATGAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377645.1-636s1c1
Sequence:CCGGGATGATCTCCTATTTCCAAATCTCGAGATTTGGAAATAGGAGATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377645.1-644s1c1
Sequence:CCGGCCTATTTCCAAATCTTCTCAACTCGAGTTGAGAAGATTTGGAAATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377645.1-332s1c1
Sequence:CCGGCCTTCCTTACTGTCATGTCTTCTCGAGAAGACATGACAGTAAGGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377645.1-153s1c1
Sequence:CCGGGCATCTTCACACACCCATGTACTCGAGTACATGGGTGTGTGAAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377645.1-495s1c1
Sequence:CCGGCGTTTGCAGATCCAGTGTGATCTCGAGATCACACTGGATCTGCAAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377645.1-333s1c1
Sequence:CCGGCTTCCTTACTGTCATGTCTTACTCGAGTAAGACATGACAGTAAGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_377645
OR14I1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 14, subfamily I, member 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000189423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377645.1-120s1c1
Sequence:CCGGCCTGCTCATCATTGCAGTCATCTCGAGATGACTGCAATGATGAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377645.1-636s1c1
Sequence:CCGGGATGATCTCCTATTTCCAAATCTCGAGATTTGGAAATAGGAGATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377645.1-644s1c1
Sequence:CCGGCCTATTTCCAAATCTTCTCAACTCGAGTTGAGAAGATTTGGAAATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377645.1-332s1c1
Sequence:CCGGCCTTCCTTACTGTCATGTCTTCTCGAGAAGACATGACAGTAAGGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377645.1-153s1c1
Sequence:CCGGGCATCTTCACACACCCATGTACTCGAGTACATGGGTGTGTGAAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377645.1-495s1c1
Sequence:CCGGCGTTTGCAGATCCAGTGTGATCTCGAGATCACACTGGATCTGCAAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377645.1-333s1c1
Sequence:CCGGCTTCCTTACTGTCATGTCTTACTCGAGTAAGACATGACAGTAAGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_377645
OR14I1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 14, subfamily I, member 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000189423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377645.1-120s1c1
Sequence:CCGGCCTGCTCATCATTGCAGTCATCTCGAGATGACTGCAATGATGAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377645.1-636s1c1
Sequence:CCGGGATGATCTCCTATTTCCAAATCTCGAGATTTGGAAATAGGAGATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377645.1-644s1c1
Sequence:CCGGCCTATTTCCAAATCTTCTCAACTCGAGTTGAGAAGATTTGGAAATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377645.1-332s1c1
Sequence:CCGGCCTTCCTTACTGTCATGTCTTCTCGAGAAGACATGACAGTAAGGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377645.1-153s1c1
Sequence:CCGGGCATCTTCACACACCCATGTACTCGAGTACATGGGTGTGTGAAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377645.1-495s1c1
Sequence:CCGGCGTTTGCAGATCCAGTGTGATCTCGAGATCACACTGGATCTGCAAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_377645.1-333s1c1
Sequence:CCGGCTTCCTTACTGTCATGTCTTACTCGAGTAAGACATGACAGTAAGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)