EMAIL THIS PAGE TO A FRIEND

OR1A1

olfactory receptor, family 1, subfamily A, member 1

17 Gene Product Result for
Synonyms: OR17-7
Species: Human OR1A1(8383)
UniProtKB ID: Q9P1Q5, A5D914, Q6IFM1, Q6NTA9, Q96R87
Gene ID:
Human(8383) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303859 ANTI-OR1A1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing
SAB4503305 Anti-OR1A1 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014565 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014565 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014565 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014565 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014565 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066537 predicted 406
2 SASI_Hs01_00066538 predicted 409
3 SASI_Hs01_00066539 predicted 320
4 SASI_Hs01_00066540 predicted 320
5 SASI_Hs01_00066541 predicted 256
6 SASI_Hs01_00066543 predicted 638
7 SASI_Hs01_00066542 predicted 560
8 SASI_Hs01_00066544 predicted 409
9 SASI_Hs01_00066545 predicted 129
10 SASI_Hs01_00066546 predicted 804
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014565
OR1A1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 1, subfamily A, member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014565.1-127s1c1
Sequence:CCGGCTGCTCATTGTCCTAGCCATTCTCGAGAATGGCTAGGACAATGAGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014565.1-318s1c1
Sequence:CCGGCTTGGGTAACACAGACAGCTACTCGAGTAGCTGTCTGTGTTACCCAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014565.1-729s1c1
Sequence:CCGGCCTCACGGTTGTCTCTTTGTACTCGAGTACAAAGAGACAACCGTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014565.1-523s1c1
Sequence:CCGGGCCAACTTCTACTGTGACATTCTCGAGAATGTCACAGTAGAAGTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014565.1-415s1c1
Sequence:CCGGCGGTCTTGTATCTGGCTTATTCTCGAGAATAAGCCAGATACAAGACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014565.1-128s21c1
Sequence:CCGGTGCTCATTGTCCTAGCCATTTCTCGAGAAATGGCTAGGACAATGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014565.1-84s21c1
Sequence:CCGGCATCCTCTTCCTGTTCATTTACTCGAGTAAATGAACAGGAAGAGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014565.1-756s21c1
Sequence:CCGGTACAGTCATGGGCACGTATTTCTCGAGAAATACGTGCCCATGACTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014565.1-322s21c1
Sequence:CCGGGGTAACACAGACAGCTATATTCTCGAGAATATAGCTGTCTGTGTTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014565
OR1A1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 1, subfamily A, member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014565.1-127s1c1
Sequence:CCGGCTGCTCATTGTCCTAGCCATTCTCGAGAATGGCTAGGACAATGAGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014565.1-318s1c1
Sequence:CCGGCTTGGGTAACACAGACAGCTACTCGAGTAGCTGTCTGTGTTACCCAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014565.1-729s1c1
Sequence:CCGGCCTCACGGTTGTCTCTTTGTACTCGAGTACAAAGAGACAACCGTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014565.1-523s1c1
Sequence:CCGGGCCAACTTCTACTGTGACATTCTCGAGAATGTCACAGTAGAAGTTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014565.1-415s1c1
Sequence:CCGGCGGTCTTGTATCTGGCTTATTCTCGAGAATAAGCCAGATACAAGACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014565.1-128s21c1
Sequence:CCGGTGCTCATTGTCCTAGCCATTTCTCGAGAAATGGCTAGGACAATGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014565.1-84s21c1
Sequence:CCGGCATCCTCTTCCTGTTCATTTACTCGAGTAAATGAACAGGAAGAGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014565.1-756s21c1
Sequence:CCGGTACAGTCATGGGCACGTATTTCTCGAGAAATACGTGCCCATGACTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014565.1-322s21c1
Sequence:CCGGGGTAACACAGACAGCTATATTCTCGAGAATATAGCTGTCTGTGTTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014565
OR1A1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 1, subfamily A, member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014565.1-127s1c1
Sequence:CCGGCTGCTCATTGTCCTAGCCATTCTCGAGAATGGCTAGGACAATGAGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014565.1-318s1c1
Sequence:CCGGCTTGGGTAACACAGACAGCTACTCGAGTAGCTGTCTGTGTTACCCAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014565.1-729s1c1
Sequence:CCGGCCTCACGGTTGTCTCTTTGTACTCGAGTACAAAGAGACAACCGTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014565.1-523s1c1
Sequence:CCGGGCCAACTTCTACTGTGACATTCTCGAGAATGTCACAGTAGAAGTTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014565.1-415s1c1
Sequence:CCGGCGGTCTTGTATCTGGCTTATTCTCGAGAATAAGCCAGATACAAGACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014565.1-128s21c1
Sequence:CCGGTGCTCATTGTCCTAGCCATTTCTCGAGAAATGGCTAGGACAATGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014565.1-84s21c1
Sequence:CCGGCATCCTCTTCCTGTTCATTTACTCGAGTAAATGAACAGGAAGAGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014565.1-756s21c1
Sequence:CCGGTACAGTCATGGGCACGTATTTCTCGAGAAATACGTGCCCATGACTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014565.1-322s21c1
Sequence:CCGGGGTAACACAGACAGCTATATTCTCGAGAATATAGCTGTCTGTGTTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)