EMAIL THIS PAGE TO A FRIEND

OR1D2

olfactory receptor, family 1, subfamily D, member 2

19 Gene Product Result for
Synonyms: OLFR1 OR17-4
Species: Human OR1D2(4991)
UniProtKB ID: P34982, Q6IFL8, Q96RA4, Q9UM78
Gene ID:
Human(4991) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002548 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002548 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002548 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002548 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126474 predicted 580
2 SASI_Hs01_00126475 predicted 544
3 SASI_Hs01_00126476 predicted 622
4 SASI_Hs01_00126477 predicted 671
5 SASI_Hs01_00126478 predicted 246
6 SASI_Hs01_00126479 predicted 634
7 SASI_Hs01_00126480 predicted 518
8 SASI_Hs01_00126482 predicted 558
9 SASI_Hs01_00126483 predicted 562
10 SASI_Hs02_00334038 predicted 644
11 SASI_Hs01_00126481 predicted 419
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002548
OR1D2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 1, subfamily D, member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002548.1-683s21c1
Sequence:CCGGTACCCTCAGTCTCTAAGAAATCTCGAGATTTCTTAGAGACTGAGGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002548.1-630s21c1
Sequence:CCGGCTTTGGATTCGTGATCATTTCCTCGAGGAAATGATCACGAATCCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002548.1-757s21c1
Sequence:CCGGGGGACACTTTGTATGGTATACCTCGAGGTATACCATACAAAGTGTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002548.1-410s21c1
Sequence:CCGGGCCCTAAGCTCTGTATCTTACCTCGAGGTAAGATACAGAGCTTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002548.1-540s1c1
Sequence:CCGGGATGTATGTATTGCTGAGGATCTCGAGATCCTCAGCAATACATACATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002548.1-746s1c1
Sequence:CCGGCCCTCTTCTATGGGACACTTTCTCGAGAAAGTGTCCCATAGAAGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002548.1-629s1c1
Sequence:CCGGCCTTTGGATTCGTGATCATTTCTCGAGAAATGATCACGAATCCAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002548.1-657s1c1
Sequence:CCGGGCTGATTATCAGAGCCATCCTCTCGAGAGGATGGCTCTGATAATCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002548.1-409s1c1
Sequence:CCGGAGCCCTAAGCTCTGTATCTTACTCGAGTAAGATACAGAGCTTAGGGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002548
OR1D2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 1, subfamily D, member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002548.1-683s21c1
Sequence:CCGGTACCCTCAGTCTCTAAGAAATCTCGAGATTTCTTAGAGACTGAGGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002548.1-630s21c1
Sequence:CCGGCTTTGGATTCGTGATCATTTCCTCGAGGAAATGATCACGAATCCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002548.1-757s21c1
Sequence:CCGGGGGACACTTTGTATGGTATACCTCGAGGTATACCATACAAAGTGTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002548.1-410s21c1
Sequence:CCGGGCCCTAAGCTCTGTATCTTACCTCGAGGTAAGATACAGAGCTTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002548.1-540s1c1
Sequence:CCGGGATGTATGTATTGCTGAGGATCTCGAGATCCTCAGCAATACATACATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002548.1-746s1c1
Sequence:CCGGCCCTCTTCTATGGGACACTTTCTCGAGAAAGTGTCCCATAGAAGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002548.1-629s1c1
Sequence:CCGGCCTTTGGATTCGTGATCATTTCTCGAGAAATGATCACGAATCCAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002548.1-657s1c1
Sequence:CCGGGCTGATTATCAGAGCCATCCTCTCGAGAGGATGGCTCTGATAATCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002548.1-409s1c1
Sequence:CCGGAGCCCTAAGCTCTGTATCTTACTCGAGTAAGATACAGAGCTTAGGGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002548
OR1D2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 1, subfamily D, member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002548.1-683s21c1
Sequence:CCGGTACCCTCAGTCTCTAAGAAATCTCGAGATTTCTTAGAGACTGAGGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002548.1-630s21c1
Sequence:CCGGCTTTGGATTCGTGATCATTTCCTCGAGGAAATGATCACGAATCCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002548.1-757s21c1
Sequence:CCGGGGGACACTTTGTATGGTATACCTCGAGGTATACCATACAAAGTGTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002548.1-410s21c1
Sequence:CCGGGCCCTAAGCTCTGTATCTTACCTCGAGGTAAGATACAGAGCTTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002548.1-540s1c1
Sequence:CCGGGATGTATGTATTGCTGAGGATCTCGAGATCCTCAGCAATACATACATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002548.1-746s1c1
Sequence:CCGGCCCTCTTCTATGGGACACTTTCTCGAGAAAGTGTCCCATAGAAGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002548.1-629s1c1
Sequence:CCGGCCTTTGGATTCGTGATCATTTCTCGAGAAATGATCACGAATCCAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002548.1-657s1c1
Sequence:CCGGGCTGATTATCAGAGCCATCCTCTCGAGAGGATGGCTCTGATAATCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002548.1-409s1c1
Sequence:CCGGAGCCCTAAGCTCTGTATCTTACTCGAGTAAGATACAGAGCTTAGGGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)