EMAIL THIS PAGE TO A FRIEND

OR1E1

olfactory receptor, family 1, subfamily E, member 1

20 Gene Product Result for
Synonyms: HGM071 OR13-66 OR17-2 OR17-32 OR1E5 OR1E6 OR1E8P OR1E9P OST547
Gene ID:
Human(8387) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(505191) olfactory receptor, family 1, subfamily E, member 1
dog(491216) olfactory receptor family 1 subfamily E
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003553 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003553 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003553 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152911 MISSION® esiRNA esiRNA human OR1E1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003553 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164875 predicted 222
2 SASI_Hs01_00164876 predicted 454
3 SASI_Hs01_00164879 predicted 217
4 SASI_Hs01_00164881 predicted 646
5 SASI_Hs02_00335829 predicted 214
6 SASI_Hs02_00335830 predicted 644
7 SASI_Hs02_00335831 predicted 457
8 SASI_Hs01_00164874 predicted 475
9 SASI_Hs02_00335832 predicted 674
10 SASI_Hs01_00164878 predicted 573
11 SASI_Hs01_00164877 predicted 462
12 SASI_Hs01_00164880 predicted 608
13 SASI_Hs01_00164882 predicted 580
14 SASI_Hs01_00164883 predicted 228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003553
OR1E1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 1, subfamily E, member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003553.2-303s21c1
Sequence:CCGGGTACTTCTTCCTGTTATTTGGCTCGAGCCAAATAACAGGAAGAAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003553.2-224s21c1
Sequence:CCGGCCGTGACCATTCCCAAGTTGTCTCGAGACAACTTGGGAATGGTCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003553.2-236s21c1
Sequence:CCGGCCAAGTTGTTACAGAACATGCCTCGAGGCATGTTCTGTAACAACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003553.2-212s21c1
Sequence:CCGGTCTGCTTCTCTTCCGTGACCACTCGAGTGGTCACGGAAGAGAAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003553.1-225s1c1
Sequence:CCGGCGTGACCATTCCCAAGTTGTTCTCGAGAACAACTTGGGAATGGTCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003553.1-642s1c1
Sequence:CCGGCCTTGGGTCCTATGCAAGAATCTCGAGATTCTTGCATAGGACCCAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003553.1-746s1c1
Sequence:CCGGCACTGTTCTATGGAACCGTTACTCGAGTAACGGTTCCATAGAACAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003553.1-165s1c1
Sequence:CCGGCCACACGCCTATGTATTTGTTCTCGAGAACAAATACATAGGCGTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003553.1-463s1c1
Sequence:CCGGCATGCCATGTTACACACTTTACTCGAGTAAAGTGTGTAACATGGCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003553
OR1E1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 1, subfamily E, member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003553.2-303s21c1
Sequence:CCGGGTACTTCTTCCTGTTATTTGGCTCGAGCCAAATAACAGGAAGAAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003553.2-224s21c1
Sequence:CCGGCCGTGACCATTCCCAAGTTGTCTCGAGACAACTTGGGAATGGTCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003553.2-236s21c1
Sequence:CCGGCCAAGTTGTTACAGAACATGCCTCGAGGCATGTTCTGTAACAACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003553.2-212s21c1
Sequence:CCGGTCTGCTTCTCTTCCGTGACCACTCGAGTGGTCACGGAAGAGAAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003553.1-225s1c1
Sequence:CCGGCGTGACCATTCCCAAGTTGTTCTCGAGAACAACTTGGGAATGGTCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003553.1-642s1c1
Sequence:CCGGCCTTGGGTCCTATGCAAGAATCTCGAGATTCTTGCATAGGACCCAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003553.1-746s1c1
Sequence:CCGGCACTGTTCTATGGAACCGTTACTCGAGTAACGGTTCCATAGAACAGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003553.1-165s1c1
Sequence:CCGGCCACACGCCTATGTATTTGTTCTCGAGAACAAATACATAGGCGTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003553.1-463s1c1
Sequence:CCGGCATGCCATGTTACACACTTTACTCGAGTAAAGTGTGTAACATGGCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003553
OR1E1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 1, subfamily E, member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003553.2-303s21c1
Sequence:CCGGGTACTTCTTCCTGTTATTTGGCTCGAGCCAAATAACAGGAAGAAGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003553.2-224s21c1
Sequence:CCGGCCGTGACCATTCCCAAGTTGTCTCGAGACAACTTGGGAATGGTCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003553.2-236s21c1
Sequence:CCGGCCAAGTTGTTACAGAACATGCCTCGAGGCATGTTCTGTAACAACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003553.2-212s21c1
Sequence:CCGGTCTGCTTCTCTTCCGTGACCACTCGAGTGGTCACGGAAGAGAAGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003553.1-225s1c1
Sequence:CCGGCGTGACCATTCCCAAGTTGTTCTCGAGAACAACTTGGGAATGGTCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003553.1-642s1c1
Sequence:CCGGCCTTGGGTCCTATGCAAGAATCTCGAGATTCTTGCATAGGACCCAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003553.1-746s1c1
Sequence:CCGGCACTGTTCTATGGAACCGTTACTCGAGTAACGGTTCCATAGAACAGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003553.1-165s1c1
Sequence:CCGGCCACACGCCTATGTATTTGTTCTCGAGAACAAATACATAGGCGTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003553.1-463s1c1
Sequence:CCGGCATGCCATGTTACACACTTTACTCGAGTAAAGTGTGTAACATGGCATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)