EMAIL THIS PAGE TO A FRIEND

OR1E2

olfactory receptor, family 1, subfamily E, member 2

20 Gene Product Result for
Synonyms: OR17-135 OR17-93 OR1E4 OR1E7 OST529
UniProtKB ID: P47887, O43877, O95632, Q0VAD5, Q0VAD6, Q9UL13
Gene ID:
Human(8388) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(491217) olfactory receptor DTMT
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301737 ANTI-OR1E2 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003554 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003554 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003554 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003554 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185544 predicted 481
2 SASI_Hs01_00185549 predicted 673
3 SASI_Hs02_00335833 predicted 671
4 SASI_Hs02_00335834 predicted 489
5 SASI_Hs01_00185543 predicted 503
6 SASI_Hs01_00185545 predicted 483
7 SASI_Hs02_00335835 predicted 701
8 SASI_Hs02_00335836 predicted 592
9 SASI_Hs01_00185546 predicted 282
10 SASI_Hs01_00185547 predicted 597
11 SASI_Hs01_00185542 predicted 595
12 SASI_Hs01_00185548 predicted 626
13 SASI_Hs01_00185550 predicted 606
14 SASI_Hs01_00185551 predicted 452
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003554
OR1E2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 1, subfamily E, member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003554.1-222s1c1
Sequence:CCGGCTCAGTCACAATGCCCAAATTCTCGAGAATTTGGGCATTGTGACTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003554.1-604s1c1
Sequence:CCGGCGAGTTAATGAATGGGTGATACTCGAGTATCACCCATTCATTAACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003554.1-489s1c1
Sequence:CCGGCCATGCCATGTTACACACTTTCTCGAGAAAGTGTGTAACATGGCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003554.1-126s1c1
Sequence:CCGGCCTCCTCATCATTGTCCTCATCTCGAGATGAGGACAATGATGAGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003554.1-321s21c1
Sequence:CCGGTTCGGATCTAGAGAGCTTCCTCTCGAGAGGAAGCTCTCTAGATCCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003554.1-298s21c1
Sequence:CCGGCAAATGTACTTCTTCTTGTATCTCGAGATACAAGAAGAAGTACATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003554.1-788s1c1
Sequence:CCGGCCGTTATTGGTCTCTACTTATCTCGAGATAAGTAGAGACCAATAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003554.1-223s21c1
Sequence:CCGGTCAGTCACAATGCCCAAATTGCTCGAGCAATTTGGGCATTGTGACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003554.1-236s21c1
Sequence:CCGGCCAAATTGCTGCAGAACATGCCTCGAGGCATGTTCTGCAGCAATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003554
OR1E2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 1, subfamily E, member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003554.1-222s1c1
Sequence:CCGGCTCAGTCACAATGCCCAAATTCTCGAGAATTTGGGCATTGTGACTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003554.1-604s1c1
Sequence:CCGGCGAGTTAATGAATGGGTGATACTCGAGTATCACCCATTCATTAACTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003554.1-489s1c1
Sequence:CCGGCCATGCCATGTTACACACTTTCTCGAGAAAGTGTGTAACATGGCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003554.1-126s1c1
Sequence:CCGGCCTCCTCATCATTGTCCTCATCTCGAGATGAGGACAATGATGAGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003554.1-321s21c1
Sequence:CCGGTTCGGATCTAGAGAGCTTCCTCTCGAGAGGAAGCTCTCTAGATCCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003554.1-298s21c1
Sequence:CCGGCAAATGTACTTCTTCTTGTATCTCGAGATACAAGAAGAAGTACATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003554.1-788s1c1
Sequence:CCGGCCGTTATTGGTCTCTACTTATCTCGAGATAAGTAGAGACCAATAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003554.1-223s21c1
Sequence:CCGGTCAGTCACAATGCCCAAATTGCTCGAGCAATTTGGGCATTGTGACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003554.1-236s21c1
Sequence:CCGGCCAAATTGCTGCAGAACATGCCTCGAGGCATGTTCTGCAGCAATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003554
OR1E2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 1, subfamily E, member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003554.1-222s1c1
Sequence:CCGGCTCAGTCACAATGCCCAAATTCTCGAGAATTTGGGCATTGTGACTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003554.1-604s1c1
Sequence:CCGGCGAGTTAATGAATGGGTGATACTCGAGTATCACCCATTCATTAACTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003554.1-489s1c1
Sequence:CCGGCCATGCCATGTTACACACTTTCTCGAGAAAGTGTGTAACATGGCATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003554.1-126s1c1
Sequence:CCGGCCTCCTCATCATTGTCCTCATCTCGAGATGAGGACAATGATGAGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003554.1-321s21c1
Sequence:CCGGTTCGGATCTAGAGAGCTTCCTCTCGAGAGGAAGCTCTCTAGATCCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003554.1-298s21c1
Sequence:CCGGCAAATGTACTTCTTCTTGTATCTCGAGATACAAGAAGAAGTACATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003554.1-788s1c1
Sequence:CCGGCCGTTATTGGTCTCTACTTATCTCGAGATAAGTAGAGACCAATAACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003554.1-223s21c1
Sequence:CCGGTCAGTCACAATGCCCAAATTGCTCGAGCAATTTGGGCATTGTGACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003554.1-236s21c1
Sequence:CCGGCCAAATTGCTGCAGAACATGCCTCGAGGCATGTTCTGCAGCAATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)