EMAIL THIS PAGE TO A FRIEND

OR1F1

olfactory receptor, family 1, subfamily F, member 1

18 Gene Product Result for
Synonyms: OLFMF OR16-36 OR16-37 OR16-88 OR16-89 OR16-90 OR1F10 OR1F13P OR1F4 OR1F5 OR1F6 OR1F7 OR1F8 OR1F9 OR3-145 ORL1023
Species: Human OR1F1(4992)
UniProtKB ID: O43749, O15246, Q6IFL5
Gene ID:
Human(4992) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302686 ANTI-OR1F1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012360 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012360 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012360 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110871 MISSION® esiRNA esiRNA human OR1F1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012360 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068395 predicted 293
2 SASI_Hs01_00068396 predicted 269
3 SASI_Hs01_00068397 predicted 566
4 SASI_Hs01_00068399 predicted 245
5 SASI_Hs01_00068400 predicted 392
6 SASI_Hs01_00068402 predicted 235
7 SASI_Hs01_00068403 predicted 486
8 SASI_Hs01_00068404 predicted 667
9 SASI_Hs02_00344162 predicted 665
10 SASI_Hs01_00068398 predicted 628
11 SASI_Hs01_00068401 predicted 684
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012360
OR1F1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 1, subfamily F, member 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000357737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012360.1-577s21c1
Sequence:CCGGCACCTCAATGAGGTCATAATCCTCGAGGATTATGACCTCATTGAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012360.1-319s21c1
Sequence:CCGGTTCGTGGACATGGACAATTTCCTCGAGGAAATTGTCCATGTCCACGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012360.1-758s1c1
Sequence:CCGGGCACCATCATTGCTGTGTATTCTCGAGAATACACAGCAATGATGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012360.1-292s1c1
Sequence:CCGGCTCACACAGATGTATTTCGTTCTCGAGAACGAAATACATCTGTGTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012360.1-433s1c1
Sequence:CCGGGTTGCTGGATTATGGGTGGTTCTCGAGAACCACCCATAATCCAGCAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012360.1-318s1c1
Sequence:CCGGGTTCGTGGACATGGACAATTTCTCGAGAAATTGTCCATGTCCACGAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012360.1-576s1c1
Sequence:CCGGACACCTCAATGAGGTCATAATCTCGAGATTATGACCTCATTGAGGTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012360
OR1F1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 1, subfamily F, member 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000357737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012360.1-577s21c1
Sequence:CCGGCACCTCAATGAGGTCATAATCCTCGAGGATTATGACCTCATTGAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012360.1-319s21c1
Sequence:CCGGTTCGTGGACATGGACAATTTCCTCGAGGAAATTGTCCATGTCCACGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012360.1-758s1c1
Sequence:CCGGGCACCATCATTGCTGTGTATTCTCGAGAATACACAGCAATGATGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012360.1-292s1c1
Sequence:CCGGCTCACACAGATGTATTTCGTTCTCGAGAACGAAATACATCTGTGTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012360.1-433s1c1
Sequence:CCGGGTTGCTGGATTATGGGTGGTTCTCGAGAACCACCCATAATCCAGCAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012360.1-318s1c1
Sequence:CCGGGTTCGTGGACATGGACAATTTCTCGAGAAATTGTCCATGTCCACGAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012360.1-576s1c1
Sequence:CCGGACACCTCAATGAGGTCATAATCTCGAGATTATGACCTCATTGAGGTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012360
OR1F1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 1, subfamily F, member 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000357737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012360.1-577s21c1
Sequence:CCGGCACCTCAATGAGGTCATAATCCTCGAGGATTATGACCTCATTGAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012360.1-319s21c1
Sequence:CCGGTTCGTGGACATGGACAATTTCCTCGAGGAAATTGTCCATGTCCACGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012360.1-758s1c1
Sequence:CCGGGCACCATCATTGCTGTGTATTCTCGAGAATACACAGCAATGATGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012360.1-292s1c1
Sequence:CCGGCTCACACAGATGTATTTCGTTCTCGAGAACGAAATACATCTGTGTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012360.1-433s1c1
Sequence:CCGGGTTGCTGGATTATGGGTGGTTCTCGAGAACCACCCATAATCCAGCAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012360.1-318s1c1
Sequence:CCGGGTTCGTGGACATGGACAATTTCTCGAGAAATTGTCCATGTCCACGAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012360.1-576s1c1
Sequence:CCGGACACCTCAATGAGGTCATAATCTCGAGATTATGACCTCATTGAGGTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)