EMAIL THIS PAGE TO A FRIEND

OR1I1

olfactory receptor, family 1, subfamily I, member 1

15 Gene Product Result for
Synonyms: OR19-20 OR1I1P OR1I1Q
UniProtKB ID: O60431, Q96R92
Gene ID:
Human(126370) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(484871) olfactory receptor, family 1, subfamily I, member 1
cow(507573) olfactory receptor, family 1, subfamily I, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305803 ANTI-OR1I1(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_065050 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_065050 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_065050 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004713 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004713 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210703 predicted 634
2 SASI_Hs01_00210704 predicted 493
3 SASI_Hs01_00210706 predicted 495
4 SASI_Hs01_00210708 predicted 199
5 SASI_Hs01_00210709 predicted 438
6 SASI_Hs01_00210710 predicted 328
7 SASI_Hs01_00210711 predicted 380
8 SASI_Hs01_00210712 predicted 313
9 SASI_Hs02_00304669 predicted 490
10 SASI_Hs02_00304670 predicted 574
11 SASI_Hs01_00210705 predicted 514
12 SASI_Hs01_00210707 predicted 338
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_065050
OR1I1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 1, subfamily I, member 1
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000203440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_065050.3-873s1c1
Sequence:CCGGCATACGGAACAAGGATATGAACTCGAGTTCATATCCTTGTTCCGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_065050.3-174s1c1
Sequence:CCGGCATGTACTTCTTTCTCTTCAACTCGAGTTGAAGAGAAAGAAGTACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_065050
OR1I1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 1, subfamily I, member 1
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000203440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_065050.3-873s1c1
Sequence:CCGGCATACGGAACAAGGATATGAACTCGAGTTCATATCCTTGTTCCGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_065050.3-174s1c1
Sequence:CCGGCATGTACTTCTTTCTCTTCAACTCGAGTTGAAGAGAAAGAAGTACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_065050
OR1I1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 1, subfamily I, member 1
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000203440    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_065050.3-873s1c1
Sequence:CCGGCATACGGAACAAGGATATGAACTCGAGTTCATATCCTTGTTCCGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_065050.3-174s1c1
Sequence:CCGGCATGTACTTCTTTCTCTTCAACTCGAGTTGAAGAGAAAGAAGTACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)