EMAIL THIS PAGE TO A FRIEND

OR1J1

olfactory receptor, family 1, subfamily J, member 1

16 Gene Product Result for
Synonyms: OR9-18 hg32
UniProtKB ID: Q8NGS3, A3KFL8, Q6IF10, Q96R88
Gene ID:
Human(347168) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(514505) olfactory receptor, family 1, subfamily J, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107427 Anti-OR1J1 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_294531 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_294531 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_294531 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004451 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004451 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020281 predicted 447
2 SASI_Hs01_00020283 predicted 510
3 SASI_Hs01_00020285 predicted 570
4 SASI_Hs02_00304593 predicted 445
5 SASI_Hs01_00020286 predicted 560
6 SASI_Hs02_00304594 predicted 368
7 SASI_Hs01_00020288 predicted 683
8 SASI_Hs01_00020289 predicted 629
9 SASI_Hs01_00020290 predicted 602
10 SASI_Hs02_00304595 predicted 607
11 SASI_Hs01_00020282 predicted 320
12 SASI_Hs01_00020284 predicted 291
13 SASI_Hs01_00020287 predicted 506
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_294531
OR1J1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 1, subfamily J, member 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000204208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294531.4-322s1c1
Sequence:CCGGGCTGACTTAGACAGTTTCCTTCTCGAGAAGGAAACTGTCTAAGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294531.4-642s1c1
Sequence:CCGGCCTGGTTTCTTATGGTCACATCTCGAGATGTGACCATAAGAAACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294531.4-757s1c1
Sequence:CCGGCGGACAATTATTGGTCTCTATCTCGAGATAGAGACCAATAATTGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294531.4-643s1c1
Sequence:CCGGCTGGTTTCTTATGGTCACATTCTCGAGAATGTGACCATAAGAAACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_294531
OR1J1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 1, subfamily J, member 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000204208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294531.4-322s1c1
Sequence:CCGGGCTGACTTAGACAGTTTCCTTCTCGAGAAGGAAACTGTCTAAGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294531.4-642s1c1
Sequence:CCGGCCTGGTTTCTTATGGTCACATCTCGAGATGTGACCATAAGAAACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294531.4-757s1c1
Sequence:CCGGCGGACAATTATTGGTCTCTATCTCGAGATAGAGACCAATAATTGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294531.4-643s1c1
Sequence:CCGGCTGGTTTCTTATGGTCACATTCTCGAGAATGTGACCATAAGAAACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_294531
OR1J1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 1, subfamily J, member 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000204208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294531.4-322s1c1
Sequence:CCGGGCTGACTTAGACAGTTTCCTTCTCGAGAAGGAAACTGTCTAAGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294531.4-642s1c1
Sequence:CCGGCCTGGTTTCTTATGGTCACATCTCGAGATGTGACCATAAGAAACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294531.4-757s1c1
Sequence:CCGGCGGACAATTATTGGTCTCTATCTCGAGATAGAGACCAATAATTGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294531.4-643s1c1
Sequence:CCGGCTGGTTTCTTATGGTCACATTCTCGAGAATGTGACCATAAGAAACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)