EMAIL THIS PAGE TO A FRIEND

OR1L1

olfactory receptor, family 1, subfamily L, member 1

15 Gene Product Result for
Synonyms: HG23 OR1L2 OR9-27 OR9-C
UniProtKB ID: Q8NH94, Q5T7Z3, Q6IFN2
Gene ID:
Human(26737) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(514342) olfactory receptor, family 1, subfamily L, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302479 ANTI-OR1L1 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005236 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005236 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005236 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005236 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005236 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092868 predicted 775
2 SASI_Hs02_00304800 predicted 652
3 SASI_Hs01_00092869 predicted 686
4 SASI_Hs01_00092870 predicted 840
5 SASI_Hs01_00092875 predicted 402
6 SASI_Hs02_00304801 predicted 644
7 SASI_Hs01_00092873 predicted 807
8 SASI_Hs01_00092874 predicted 540
9 SASI_Hs01_00092876 predicted 682
10 SASI_Hs01_00092877 predicted 258
11 SASI_Hs01_00092871 predicted 623
12 SASI_Hs01_00092872 predicted 427
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005236
OR1L1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 1, subfamily L, member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005236.1-686s1c1
Sequence:CCGGGCGATGATCAACCAGTGCTAACTCGAGTTAGCACTGGTTGATCATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005236.1-752s1c2
Sequence:CCGGCAGAAGGCTTGGCTGTCATAACTCGAGTTATGACAGCCAAGCCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005236.1-137s1c1
Sequence:CCGGGTGAACCCACAACTATGGGAACTCGAGTTCCCATAGTTGTGGGTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005236.1-131s1c1
Sequence:CCGGCTTTAGGTGAACCCACAACTACTCGAGTAGTTGTGGGTTCACCTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005236.1-468s1c2
Sequence:CCGGCTTTGGAAACACAGACAGTTACTCGAGTAACTGTCTGTGTTTCCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005236
OR1L1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 1, subfamily L, member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005236.1-686s1c1
Sequence:CCGGGCGATGATCAACCAGTGCTAACTCGAGTTAGCACTGGTTGATCATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005236.1-752s1c2
Sequence:CCGGCAGAAGGCTTGGCTGTCATAACTCGAGTTATGACAGCCAAGCCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005236.1-137s1c1
Sequence:CCGGGTGAACCCACAACTATGGGAACTCGAGTTCCCATAGTTGTGGGTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005236.1-131s1c1
Sequence:CCGGCTTTAGGTGAACCCACAACTACTCGAGTAGTTGTGGGTTCACCTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005236.1-468s1c2
Sequence:CCGGCTTTGGAAACACAGACAGTTACTCGAGTAACTGTCTGTGTTTCCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005236
OR1L1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 1, subfamily L, member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005236.1-686s1c1
Sequence:CCGGGCGATGATCAACCAGTGCTAACTCGAGTTAGCACTGGTTGATCATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005236.1-752s1c2
Sequence:CCGGCAGAAGGCTTGGCTGTCATAACTCGAGTTATGACAGCCAAGCCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005236.1-137s1c1
Sequence:CCGGGTGAACCCACAACTATGGGAACTCGAGTTCCCATAGTTGTGGGTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005236.1-131s1c1
Sequence:CCGGCTTTAGGTGAACCCACAACTACTCGAGTAGTTGTGGGTTCACCTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005236.1-468s1c2
Sequence:CCGGCTTTGGAAACACAGACAGTTACTCGAGTAACTGTCTGTGTTTCCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)