EMAIL THIS PAGE TO A FRIEND

OR1L6

olfactory receptor, family 1, subfamily L, member 6

7 Gene Product Result for
Synonyms: HG16 OR1L7 OR9-30
UniProtKB ID: Q8NGR2, Q6IFM8, Q96R80
Gene ID:
Human(392390) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(491345) olfactory receptor, family 1, subfamily L, member 6
cow(786664) olfactory receptor, family 1, subfamily L, member 6
cow(614814) olfactory receptor, family 1, subfamily L, member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501732 Anti-OR1L6 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004453 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004453 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004453 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004453 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105744 predicted 868
2 SASI_Hs01_00105745 predicted 40
3 SASI_Hs01_00105746 predicted 865
4 SASI_Hs01_00105747 predicted 1007
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004453
OR1L6 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 1, subfamily L, member 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004453.1-744s1c1
Sequence:CCGGCCTGTGTATCATCTTCTCCTACTCGAGTAGGAGAAGATGATACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004453.1-96s1c1
Sequence:CCGGGAAGTCCAGAGACATGGAGATCTCGAGATCTCCATGTCTCTGGACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004453.1-497s1c1
Sequence:CCGGCCTTACACTATGATGTGGTTACTCGAGTAACCACATCATAGTGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004453.1-40s1c1
Sequence:CCGGGTCTTGGTCAAACTGCCCTTTCTCGAGAAAGGGCAGTTTGACCAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004453.1-588s1c1
Sequence:CCGGCGTGCTACTTATGTCTCGCTTCTCGAGAAGCGAGACATAAGTAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004453
OR1L6 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 1, subfamily L, member 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004453.1-744s1c1
Sequence:CCGGCCTGTGTATCATCTTCTCCTACTCGAGTAGGAGAAGATGATACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004453.1-96s1c1
Sequence:CCGGGAAGTCCAGAGACATGGAGATCTCGAGATCTCCATGTCTCTGGACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004453.1-497s1c1
Sequence:CCGGCCTTACACTATGATGTGGTTACTCGAGTAACCACATCATAGTGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004453.1-40s1c1
Sequence:CCGGGTCTTGGTCAAACTGCCCTTTCTCGAGAAAGGGCAGTTTGACCAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004453.1-588s1c1
Sequence:CCGGCGTGCTACTTATGTCTCGCTTCTCGAGAAGCGAGACATAAGTAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004453
OR1L6 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 1, subfamily L, member 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004453.1-744s1c1
Sequence:CCGGCCTGTGTATCATCTTCTCCTACTCGAGTAGGAGAAGATGATACACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004453.1-96s1c1
Sequence:CCGGGAAGTCCAGAGACATGGAGATCTCGAGATCTCCATGTCTCTGGACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004453.1-497s1c1
Sequence:CCGGCCTTACACTATGATGTGGTTACTCGAGTAACCACATCATAGTGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004453.1-40s1c1
Sequence:CCGGGTCTTGGTCAAACTGCCCTTTCTCGAGAAAGGGCAGTTTGACCAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004453.1-588s1c1
Sequence:CCGGCGTGCTACTTATGTCTCGCTTCTCGAGAAGCGAGACATAAGTAGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)