EMAIL THIS PAGE TO A FRIEND

OR1M1

olfactory receptor, family 1, subfamily M, member 1

16 Gene Product Result for
Synonyms: OR19-5 OR19-6
UniProtKB ID: Q8NGA1, B9EHA6, Q6IFJ3, Q96R91
Gene ID:
Human(125963) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(786833) olfactory receptor, family 1, subfamily M, member 1
dog(484987) olfactory receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302199 ANTI-OR1M1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_064884 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_064884 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_064884 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111641 MISSION® esiRNA esiRNA human OR1M1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004456 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113698 predicted 216
2 SASI_Hs01_00113699 predicted 258
3 SASI_Hs01_00113700 predicted 644
4 SASI_Hs01_00113701 predicted 475
5 SASI_Hs01_00113702 predicted 507
6 SASI_Hs01_00113703 predicted 327
7 SASI_Hs01_00113704 predicted 222
8 SASI_Hs01_00113706 predicted 378
9 SASI_Hs02_00304597 predicted 565
10 SASI_Hs02_00304598 predicted 232
11 SASI_Hs01_00113705 predicted 484
12 SASI_Hs01_00113707 predicted 469
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_064884
OR1M1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 1, subfamily M, member 1
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000188855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064884.1-458s1c1
Sequence:CCGGGCTTCATCTCACTCACTCACACTCGAGTGTGAGTGAGTGAGATGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064884.1-291s1c1
Sequence:CCGGCCTGATCCAGATGTACTTCTTCTCGAGAAGAAGTACATCTGGATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064884.1-300s1c1
Sequence:CCGGGATGTACTTCTTCCATTTCTTCTCGAGAAGAAATGGAAGAAGTACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_064884
OR1M1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 1, subfamily M, member 1
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000188855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064884.1-458s1c1
Sequence:CCGGGCTTCATCTCACTCACTCACACTCGAGTGTGAGTGAGTGAGATGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064884.1-291s1c1
Sequence:CCGGCCTGATCCAGATGTACTTCTTCTCGAGAAGAAGTACATCTGGATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064884.1-300s1c1
Sequence:CCGGGATGTACTTCTTCCATTTCTTCTCGAGAAGAAATGGAAGAAGTACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_064884
OR1M1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 1, subfamily M, member 1
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000188855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064884.1-458s1c1
Sequence:CCGGGCTTCATCTCACTCACTCACACTCGAGTGTGAGTGAGTGAGATGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187395    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064884.1-291s1c1
Sequence:CCGGCCTGATCCAGATGTACTTCTTCTCGAGAAGAAGTACATCTGGATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_064884.1-300s1c1
Sequence:CCGGGATGTACTTCTTCCATTTCTTCTCGAGAAGAAATGGAAGAAGTACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)