EMAIL THIS PAGE TO A FRIEND

OR1N2

olfactory receptor, family 1, subfamily N, member 2

16 Gene Product Result for
Synonyms: OR9-23
Species: Human OR1N2(138882)
UniProtKB ID: Q8NGR9, A3KFM2, B2RNY4, Q6IF17, Q96RA3
Gene ID:
Human(138882) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302177 ANTI-OR1N2 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004457 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004457 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004457 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148001 MISSION® esiRNA esiRNA human OR1N2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004457 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004457 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156607 predicted 571
2 SASI_Hs01_00156608 predicted 323
3 SASI_Hs01_00156609 predicted 334
4 SASI_Hs01_00156612 predicted 441
5 SASI_Hs01_00156613 predicted 354
6 SASI_Hs01_00156614 predicted 315
7 SASI_Hs01_00156615 predicted 680
8 SASI_Hs01_00156616 predicted 326
9 SASI_Hs02_00304599 predicted 311
10 SASI_Hs02_00304600 predicted 340
11 SASI_Hs01_00156610 predicted 574
12 SASI_Hs01_00156611 predicted 198
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004457
OR1N2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 1, subfamily N, member 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004457.1-312s1c1
Sequence:CCGGCCAGAGTCAGATCATCTCGTACTCGAGTACGAGATGATCTGACTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004457.1-346s1c1
Sequence:CCGGGCACAGCTATATTTCCTCCTTCTCGAGAAGGAGGAAATATAGCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004457.1-821s1c1
Sequence:CCGGGTGTGTATTTACTTCCTCCATCTCGAGATGGAGGAAGTAAATACACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004457.1-615s1c1
Sequence:CCGGCTGCTCAGATACCCATGTAAACTCGAGTTTACATGGGTATCTGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004457.1-796s1c1
Sequence:CCGGCTGCTCTTCTATGGGTCTCTTCTCGAGAAGAGACCCATAGAAGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004457
OR1N2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 1, subfamily N, member 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004457.1-312s1c1
Sequence:CCGGCCAGAGTCAGATCATCTCGTACTCGAGTACGAGATGATCTGACTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004457.1-346s1c1
Sequence:CCGGGCACAGCTATATTTCCTCCTTCTCGAGAAGGAGGAAATATAGCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004457.1-821s1c1
Sequence:CCGGGTGTGTATTTACTTCCTCCATCTCGAGATGGAGGAAGTAAATACACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004457.1-615s1c1
Sequence:CCGGCTGCTCAGATACCCATGTAAACTCGAGTTTACATGGGTATCTGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004457.1-796s1c1
Sequence:CCGGCTGCTCTTCTATGGGTCTCTTCTCGAGAAGAGACCCATAGAAGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004457
OR1N2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 1, subfamily N, member 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004457.1-312s1c1
Sequence:CCGGCCAGAGTCAGATCATCTCGTACTCGAGTACGAGATGATCTGACTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004457.1-346s1c1
Sequence:CCGGGCACAGCTATATTTCCTCCTTCTCGAGAAGGAGGAAATATAGCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004457.1-821s1c1
Sequence:CCGGGTGTGTATTTACTTCCTCCATCTCGAGATGGAGGAAGTAAATACACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004457.1-615s1c1
Sequence:CCGGCTGCTCAGATACCCATGTAAACTCGAGTTTACATGGGTATCTGAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004457.1-796s1c1
Sequence:CCGGCTGCTCTTCTATGGGTCTCTTCTCGAGAAGAGACCCATAGAAGAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)