EMAIL THIS PAGE TO A FRIEND

OR1Q1

olfactory receptor, family 1, subfamily Q, member 1

17 Gene Product Result for
Synonyms: HSTPCR106 OR1Q2 OR1Q3 OR9-25 OR9-A OST226 OST226OR9-A TPCR106
UniProtKB ID: Q15612, Q6IFN4, Q8NGR7, Q96R82
Gene ID:
Human(158131) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(538946) olfactory receptor, family 1, subfamily Q, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_088491 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_088491 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_088491 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU139241 MISSION® esiRNA esiRNA human OR1Q1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012364 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012364 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129896 predicted 586
2 SASI_Hs01_00129897 predicted 390
3 SASI_Hs01_00129898 predicted 492
4 SASI_Hs01_00129899 predicted 571
5 SASI_Hs01_00129901 predicted 416
6 SASI_Hs01_00129902 predicted 230
7 SASI_Hs02_00344164 predicted 389
8 SASI_Hs01_00129903 predicted 280
9 SASI_Hs01_00129904 predicted 563
10 SASI_Hs01_00129905 predicted 406
11 SASI_Hs01_00129900 predicted 268
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_088491
OR1Q1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 1, subfamily Q, member 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088491.1-202s1c1
Sequence:CCGGCTTCCTCAGTAACTTGGCCTTCTCGAGAAGGCCAAGTTACTGAGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088491.1-145s1c1
Sequence:CCGGCTTGGCCATCATCACACTGATCTCGAGATCAGTGTGATGATGGCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088491.1-192s1c1
Sequence:CCGGCCATGTACATCTTCCTCAGTACTCGAGTACTGAGGAAGATGTACATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088491.1-124s1c1
Sequence:CCGGCGCAATCAATATTTCTGGCAACTCGAGTTGCCAGAAATATTGATTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088491.1-254s1c1
Sequence:CCGGCCCAAGATGCTGCAGATTATTCTCGAGAATAATCTGCAGCATCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088491.1-89s1c1
Sequence:CCGGCAAATCCCACTCTTCCTTGTTCTCGAGAACAAGGAAGAGTGGGATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_088491
OR1Q1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 1, subfamily Q, member 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088491.1-202s1c1
Sequence:CCGGCTTCCTCAGTAACTTGGCCTTCTCGAGAAGGCCAAGTTACTGAGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088491.1-145s1c1
Sequence:CCGGCTTGGCCATCATCACACTGATCTCGAGATCAGTGTGATGATGGCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088491.1-192s1c1
Sequence:CCGGCCATGTACATCTTCCTCAGTACTCGAGTACTGAGGAAGATGTACATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088491.1-124s1c1
Sequence:CCGGCGCAATCAATATTTCTGGCAACTCGAGTTGCCAGAAATATTGATTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088491.1-254s1c1
Sequence:CCGGCCCAAGATGCTGCAGATTATTCTCGAGAATAATCTGCAGCATCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088491.1-89s1c1
Sequence:CCGGCAAATCCCACTCTTCCTTGTTCTCGAGAACAAGGAAGAGTGGGATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_088491
OR1Q1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 1, subfamily Q, member 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088491.1-202s1c1
Sequence:CCGGCTTCCTCAGTAACTTGGCCTTCTCGAGAAGGCCAAGTTACTGAGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088491.1-145s1c1
Sequence:CCGGCTTGGCCATCATCACACTGATCTCGAGATCAGTGTGATGATGGCCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088491.1-192s1c1
Sequence:CCGGCCATGTACATCTTCCTCAGTACTCGAGTACTGAGGAAGATGTACATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088491.1-124s1c1
Sequence:CCGGCGCAATCAATATTTCTGGCAACTCGAGTTGCCAGAAATATTGATTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088491.1-254s1c1
Sequence:CCGGCCCAAGATGCTGCAGATTATTCTCGAGAATAATCTGCAGCATCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088491.1-89s1c1
Sequence:CCGGCAAATCCCACTCTTCCTTGTTCTCGAGAACAAGGAAGAGTGGGATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)