EMAIL THIS PAGE TO A FRIEND

OR1S1

olfactory receptor, family 1, subfamily S, member 1

11 Gene Product Result for
Synonyms: OR11-232 OST034
UniProtKB ID: Q8NH92, Q6IFG3
Gene ID:
Human(219959) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(483481) olfactory receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107429 Anti-OR1S1 antibody produced in rabbit affinity isolated antibody horse, guinea pig, rabbit, human
ELISA, western blot pricing
SAB2107430 Anti-OR1S1 antibody produced in rabbit affinity isolated antibody human, horse, guinea pig, rabbit
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004458 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004458 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004458 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004458 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131497 predicted 225
2 SASI_Hs01_00131498 predicted 206
3 SASI_Hs01_00131500 predicted 293
4 SASI_Hs01_00131501 predicted 220
5 SASI_Hs01_00131499 predicted 421
6 SASI_Hs01_00131502 predicted 708
7 SASI_Hs01_00131503 predicted 175
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004458
OR1S1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 1, subfamily S, member 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004458.1-231s1c1
Sequence:CCGGCAATCTATCCTTTGCTGATATCTCGAGATATCAGCAAAGGATAGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004458.1-423s1c1
Sequence:CCGGCCCTCTGAATTATACAATTCTCTCGAGAGAATTGTATAATTCAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004458.1-92s1c1
Sequence:CCGGTCAAGCAGGATGAGCATCAAACTCGAGTTTGATGCTCATCCTGCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004458.1-667s1c1
Sequence:CCGGCCCTTTACACTCAGCTTCTTTCTCGAGAAAGAAGCTGAGTGTAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004458.1-188s1c1
Sequence:CCGGGCTTGGATACGTACCTTCATACTCGAGTATGAAGGTACGTATCCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004458
OR1S1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 1, subfamily S, member 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004458.1-231s1c1
Sequence:CCGGCAATCTATCCTTTGCTGATATCTCGAGATATCAGCAAAGGATAGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004458.1-423s1c1
Sequence:CCGGCCCTCTGAATTATACAATTCTCTCGAGAGAATTGTATAATTCAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004458.1-92s1c1
Sequence:CCGGTCAAGCAGGATGAGCATCAAACTCGAGTTTGATGCTCATCCTGCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004458.1-667s1c1
Sequence:CCGGCCCTTTACACTCAGCTTCTTTCTCGAGAAAGAAGCTGAGTGTAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004458.1-188s1c1
Sequence:CCGGGCTTGGATACGTACCTTCATACTCGAGTATGAAGGTACGTATCCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004458
OR1S1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 1, subfamily S, member 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004458.1-231s1c1
Sequence:CCGGCAATCTATCCTTTGCTGATATCTCGAGATATCAGCAAAGGATAGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004458.1-423s1c1
Sequence:CCGGCCCTCTGAATTATACAATTCTCTCGAGAGAATTGTATAATTCAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004458.1-92s1c1
Sequence:CCGGTCAAGCAGGATGAGCATCAAACTCGAGTTTGATGCTCATCCTGCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004458.1-667s1c1
Sequence:CCGGCCCTTTACACTCAGCTTCTTTCTCGAGAAAGAAGCTGAGTGTAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004458.1-188s1c1
Sequence:CCGGGCTTGGATACGTACCTTCATACTCGAGTATGAAGGTACGTATCCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)