EMAIL THIS PAGE TO A FRIEND

OR2A1

olfactory receptor, family 2, subfamily A, member 1

9 Gene Product Result for
Species: Human OR2A1(346528)
UniProtKB ID: Q8NGT9, Q6IF44, Q96R46
Gene ID:
Human(346528) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501515 Anti-OR2A42 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_294318 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_294318 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_294318 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005287 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005287 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030639 predicted 325
2 SASI_Hs01_00030640 predicted 381
3 SASI_Hs01_00030641 predicted 488
4 SASI_Hs01_00030642 predicted 380
5 SASI_Hs01_00030643 predicted 284
6 SASI_Hs01_00030644 predicted 896
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_294318
OR2A1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily A, member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000188137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294318.2-93s1c1
Sequence:CCGGCCTGTTCTATATCTTCACCCTCTCGAGAGGGTGAAGATATAGAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294318.2-756s1c1
Sequence:CCGGCAGTGCCATCATCATGTACATCTCGAGATGTACATGATGATGGCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294318.2-577s1c1
Sequence:CCGGCTCAACCAGGTGGTCATCTTTCTCGAGAAAGATGACCACCTGGTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294318.2-345s1c2
Sequence:CCGGGCTGATGTCCTACGATCGTTACTCGAGTAACGATCGTAGGACATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294318.2-87s1c1
Sequence:CCGGCTTCTCCCTGTTCTATATCTTCTCGAGAAGATATAGAACAGGGAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294318.2-507s1c1
Sequence:CCGGGCCTCATGAAATCAACCACTTCTCGAGAAGTGGTTGATTTCATGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294318.2-470s1c1
Sequence:CCGGCCCATGTGGTTCTCATCCTAACTCGAGTTAGGATGAGAACCACATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294318.2-291s1c1
Sequence:CCGGGACGCAGACCTTTCTCTGTTTCTCGAGAAACAGAGAAAGGTCTGCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_294318
OR2A1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily A, member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000188137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294318.2-93s1c1
Sequence:CCGGCCTGTTCTATATCTTCACCCTCTCGAGAGGGTGAAGATATAGAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294318.2-756s1c1
Sequence:CCGGCAGTGCCATCATCATGTACATCTCGAGATGTACATGATGATGGCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294318.2-577s1c1
Sequence:CCGGCTCAACCAGGTGGTCATCTTTCTCGAGAAAGATGACCACCTGGTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294318.2-345s1c2
Sequence:CCGGGCTGATGTCCTACGATCGTTACTCGAGTAACGATCGTAGGACATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294318.2-87s1c1
Sequence:CCGGCTTCTCCCTGTTCTATATCTTCTCGAGAAGATATAGAACAGGGAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294318.2-507s1c1
Sequence:CCGGGCCTCATGAAATCAACCACTTCTCGAGAAGTGGTTGATTTCATGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294318.2-470s1c1
Sequence:CCGGCCCATGTGGTTCTCATCCTAACTCGAGTTAGGATGAGAACCACATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294318.2-291s1c1
Sequence:CCGGGACGCAGACCTTTCTCTGTTTCTCGAGAAACAGAGAAAGGTCTGCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_294318
OR2A1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily A, member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000188137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294318.2-93s1c1
Sequence:CCGGCCTGTTCTATATCTTCACCCTCTCGAGAGGGTGAAGATATAGAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294318.2-756s1c1
Sequence:CCGGCAGTGCCATCATCATGTACATCTCGAGATGTACATGATGATGGCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294318.2-577s1c1
Sequence:CCGGCTCAACCAGGTGGTCATCTTTCTCGAGAAAGATGACCACCTGGTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294318.2-345s1c2
Sequence:CCGGGCTGATGTCCTACGATCGTTACTCGAGTAACGATCGTAGGACATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294318.2-87s1c1
Sequence:CCGGCTTCTCCCTGTTCTATATCTTCTCGAGAAGATATAGAACAGGGAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294318.2-507s1c1
Sequence:CCGGGCCTCATGAAATCAACCACTTCTCGAGAAGTGGTTGATTTCATGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294318.2-470s1c1
Sequence:CCGGCCCATGTGGTTCTCATCCTAACTCGAGTTAGGATGAGAACCACATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_294318.2-291s1c1
Sequence:CCGGGACGCAGACCTTTCTCTGTTTCTCGAGAAACAGAGAAAGGTCTGCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)