EMAIL THIS PAGE TO A FRIEND

OR2A25

olfactory receptor, family 2, subfamily A, member 25

14 Gene Product Result for
Synonyms: OR2A24P OR2A25P OR2A27
UniProtKB ID: A4D2G3, B2RNC9
Gene ID:
Human(392138) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(532446) olfactory receptor, family 2, subfamily A, member 25
dog(482724) olfactory receptor, family 2, subfamily A, member 25
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501731 Anti-OR2A25 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_373210 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_373210 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_373210 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004488 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004488 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126394 predicted 463
2 SASI_Hs01_00126395 predicted 421
3 SASI_Hs01_00126396 predicted 278
4 SASI_Hs01_00126397 predicted 411
5 SASI_Hs01_00126399 predicted 531
6 SASI_Hs01_00126400 predicted 461
7 SASI_Hs01_00126401 predicted 452
8 SASI_Hs01_00126402 predicted 566
9 SASI_Hs01_00126403 predicted 626
10 SASI_Hs02_00304634 predicted 383
11 SASI_Hs01_00126398 predicted 634
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_373210
OR2A25 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily A, member 25
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000204406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373210.1-381s1c1
Sequence:CCGGCCCTCTCCGATATTCTACCATCTCGAGATGGTAGAATATCGGAGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373210.1-28s1c1
Sequence:CCGGGAGTTCCTCCTACTGGGATTTCTCGAGAAATCCCAGTAGGAGGAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373210.1-652s1c1
Sequence:CCGGGTTCATATTCTATGTGCCATTCTCGAGAATGGCACATAGAATATGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_373210
OR2A25 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily A, member 25
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000204406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373210.1-381s1c1
Sequence:CCGGCCCTCTCCGATATTCTACCATCTCGAGATGGTAGAATATCGGAGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373210.1-28s1c1
Sequence:CCGGGAGTTCCTCCTACTGGGATTTCTCGAGAAATCCCAGTAGGAGGAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373210.1-652s1c1
Sequence:CCGGGTTCATATTCTATGTGCCATTCTCGAGAATGGCACATAGAATATGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_373210
OR2A25 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily A, member 25
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000204406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373210.1-381s1c1
Sequence:CCGGCCCTCTCCGATATTCTACCATCTCGAGATGGTAGAATATCGGAGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373210.1-28s1c1
Sequence:CCGGGAGTTCCTCCTACTGGGATTTCTCGAGAAATCCCAGTAGGAGGAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_373210.1-652s1c1
Sequence:CCGGGTTCATATTCTATGTGCCATTCTCGAGAATGGCACATAGAATATGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)