EMAIL THIS PAGE TO A FRIEND

OR2A2

olfactory receptor, family 2, subfamily A, member 2

14 Gene Product Result for
Synonyms: OR2A17P OR2A2P OR7-11 OST008
UniProtKB ID: Q6IF42, B2RN85, Q8NGT6
Gene ID:
Human(442361) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(787688) olfactory receptor, family 2, subfamily A, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1402097 Monoclonal Anti-OR2A2 antibody produced in mouse clone 4B10, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005480 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005480 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005480 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005480 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005480 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143967 predicted 569
2 SASI_Hs01_00143968 predicted 572
3 SASI_Hs01_00143969 predicted 738
4 SASI_Hs01_00143971 predicted 426
5 SASI_Hs01_00143972 predicted 481
6 SASI_Hs01_00143973 predicted 509
7 SASI_Hs01_00143974 predicted 727
8 SASI_Hs01_00143975 predicted 236
9 SASI_Hs01_00143976 predicted 315
10 SASI_Hs02_00304944 predicted 733
11 SASI_Hs01_00143970 predicted 731
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005480
OR2A2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily A, member 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005480.1-668s1c1
Sequence:CCGGCCATCCTGAAGATCCAGACAACTCGAGTTGTCTGGATCTTCAGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005480.1-732s1c1
Sequence:CCGGGTGTGTGGTTGGACTATTCTTCTCGAGAAGAATAGTCCAACCACACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005480.1-780s1c1
Sequence:CCGGCCCAGACTCTAATCAACGAGACTCGAGTCTCGTTGATTAGAGTCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005480.1-577s1c1
Sequence:CCGGGTTAACCAAGTGGTCATATTTCTCGAGAAATATGACCACTTGGTTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005480.1-232s1c1
Sequence:CCGGCCCAAGATGTTGGCAAACCTACTCGAGTAGGTTTGCCAACATCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005480.1-460s1c1
Sequence:CCGGCTGTCCCTGGTACATGAAATTCTCGAGAATTTCATGTACCAGGGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005480
OR2A2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily A, member 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005480.1-668s1c1
Sequence:CCGGCCATCCTGAAGATCCAGACAACTCGAGTTGTCTGGATCTTCAGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005480.1-732s1c1
Sequence:CCGGGTGTGTGGTTGGACTATTCTTCTCGAGAAGAATAGTCCAACCACACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005480.1-780s1c1
Sequence:CCGGCCCAGACTCTAATCAACGAGACTCGAGTCTCGTTGATTAGAGTCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005480.1-577s1c1
Sequence:CCGGGTTAACCAAGTGGTCATATTTCTCGAGAAATATGACCACTTGGTTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005480.1-232s1c1
Sequence:CCGGCCCAAGATGTTGGCAAACCTACTCGAGTAGGTTTGCCAACATCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005480.1-460s1c1
Sequence:CCGGCTGTCCCTGGTACATGAAATTCTCGAGAATTTCATGTACCAGGGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005480
OR2A2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily A, member 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204475    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005480.1-668s1c1
Sequence:CCGGCCATCCTGAAGATCCAGACAACTCGAGTTGTCTGGATCTTCAGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204072    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005480.1-732s1c1
Sequence:CCGGGTGTGTGGTTGGACTATTCTTCTCGAGAAGAATAGTCCAACCACACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005480.1-780s1c1
Sequence:CCGGCCCAGACTCTAATCAACGAGACTCGAGTCTCGTTGATTAGAGTCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185273    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005480.1-577s1c1
Sequence:CCGGGTTAACCAAGTGGTCATATTTCTCGAGAAATATGACCACTTGGTTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188382    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005480.1-232s1c1
Sequence:CCGGCCCAAGATGTTGGCAAACCTACTCGAGTAGGTTTGCCAACATCTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005480.1-460s1c1
Sequence:CCGGCTGTCCCTGGTACATGAAATTCTCGAGAATTTCATGTACCAGGGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)