EMAIL THIS PAGE TO A FRIEND

OR2AE1

olfactory receptor, family 2, subfamily AE, member 1

17 Gene Product Result for
Synonyms: OR2AE2
UniProtKB ID: Q8NHA4, B2RPD2
Gene ID:
Human(81392) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(514702) olfactory receptor, family 2, subfamily AE, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005276 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005276 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005276 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU218431 MISSION® esiRNA esiRNA targeting human OR2AE1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005276 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005276 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225125 predicted 494
2 SASI_Hs01_00225126 predicted 260
3 SASI_Hs01_00225127 predicted 460
4 SASI_Hs02_00304818 predicted 584
5 SASI_Hs01_00225128 predicted 636
6 SASI_Hs01_00225129 predicted 241
7 SASI_Hs01_00225130 predicted 412
8 SASI_Hs01_00225131 predicted 623
9 SASI_Hs01_00225132 predicted 250
10 SASI_Hs01_00225133 predicted 244
11 SASI_Hs01_00225134 predicted 306
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005276
OR2AE1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily AE, member 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000189276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005276.1-732s1c1
Sequence:CCGGCACGGTGGTTTCTCTTTGGTTCTCGAGAACCAAAGAGAAACCACCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005276.1-636s1c1
Sequence:CCGGGATTTCTACATCCTATGTCTTCTCGAGAAGACATAGGATGTAGAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005276.1-544s1c1
Sequence:CCGGCCAGCTGTTGTGAAGTTGGTACTCGAGTACCAACTTCACAACAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005276.1-159s1c1
Sequence:CCGGCCAGCTTCATACACCAATGTACTCGAGTACATTGGTGTATGAAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005276
OR2AE1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily AE, member 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000189276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005276.1-732s1c1
Sequence:CCGGCACGGTGGTTTCTCTTTGGTTCTCGAGAACCAAAGAGAAACCACCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005276.1-636s1c1
Sequence:CCGGGATTTCTACATCCTATGTCTTCTCGAGAAGACATAGGATGTAGAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005276.1-544s1c1
Sequence:CCGGCCAGCTGTTGTGAAGTTGGTACTCGAGTACCAACTTCACAACAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005276.1-159s1c1
Sequence:CCGGCCAGCTTCATACACCAATGTACTCGAGTACATTGGTGTATGAAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005276
OR2AE1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily AE, member 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000189276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005276.1-732s1c1
Sequence:CCGGCACGGTGGTTTCTCTTTGGTTCTCGAGAACCAAAGAGAAACCACCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005276.1-636s1c1
Sequence:CCGGGATTTCTACATCCTATGTCTTCTCGAGAAGACATAGGATGTAGAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005276.1-544s1c1
Sequence:CCGGCCAGCTGTTGTGAAGTTGGTACTCGAGTACCAACTTCACAACAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005276.1-159s1c1
Sequence:CCGGCCAGCTTCATACACCAATGTACTCGAGTACATTGGTGTATGAAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)