EMAIL THIS PAGE TO A FRIEND

OR2AG2

olfactory receptor, family 2, subfamily AG, member 2

15 Gene Product Result for
Synonyms: OR11-76 OR2AG2P
UniProtKB ID: A6NM03
Gene ID:
Human(338755) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(509651) olfactory receptor, family 2, subfamily AG, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301965 ANTI-OR2AG2 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_291980 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_291980 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_291980 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU110741 MISSION® esiRNA esiRNA human OR2AG2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004490 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004490 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236956 predicted 472
2 SASI_Hs02_00304636 predicted 404
3 SASI_Hs01_00236957 predicted 451
4 SASI_Hs01_00236958 predicted 395
5 SASI_Hs01_00236959 predicted 584
6 SASI_Hs01_00236960 predicted 645
7 SASI_Hs01_00236961 predicted 666
8 SASI_Hs01_00236962 predicted 446
9 SASI_Hs01_00236963 predicted 626
10 SASI_Hs01_00236964 predicted 604
11 SASI_Hs01_00236965 predicted 461
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_291980
OR2AG2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily AG, member 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000203145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291980.3-78s1c1
Sequence:CCGGGCTCTATGCTACATTTACAATCTCGAGATTGTAAATGTAGCATAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291980.3-375s1c1
Sequence:CCGGCATTTGTCATCCTCTGAAATACTCGAGTATTTCAGAGGATGACAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291980.3-663s1c1
Sequence:CCGGCCTATTCACTGTGCTTCGTATCTCGAGATACGAAGCACAGTGAATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291980.3-208s1c1
Sequence:CCGGGACCTCCTGTTCACATCTGTTCTCGAGAACAGATGTGAACAGGAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_291980
OR2AG2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily AG, member 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000203145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291980.3-78s1c1
Sequence:CCGGGCTCTATGCTACATTTACAATCTCGAGATTGTAAATGTAGCATAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291980.3-375s1c1
Sequence:CCGGCATTTGTCATCCTCTGAAATACTCGAGTATTTCAGAGGATGACAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291980.3-663s1c1
Sequence:CCGGCCTATTCACTGTGCTTCGTATCTCGAGATACGAAGCACAGTGAATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291980.3-208s1c1
Sequence:CCGGGACCTCCTGTTCACATCTGTTCTCGAGAACAGATGTGAACAGGAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_291980
OR2AG2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily AG, member 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000203145    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291980.3-78s1c1
Sequence:CCGGGCTCTATGCTACATTTACAATCTCGAGATTGTAAATGTAGCATAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291980.3-375s1c1
Sequence:CCGGCATTTGTCATCCTCTGAAATACTCGAGTATTTCAGAGGATGACAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188136    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291980.3-663s1c1
Sequence:CCGGCCTATTCACTGTGCTTCGTATCTCGAGATACGAAGCACAGTGAATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291980.3-208s1c1
Sequence:CCGGGACCTCCTGTTCACATCTGTTCTCGAGAACAGATGTGAACAGGAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)