EMAIL THIS PAGE TO A FRIEND

OR2AK2

olfactory receptor, family 2, subfamily AK, member 2

17 Gene Product Result for
Synonyms: OR1-47 OR2AK1P
Species: Human OR2AK2(391191)
UniProtKB ID: Q8NG84, B2RND1, Q6IF05
Gene ID:
Human(391191) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004491 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004491 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004491 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119731 MISSION® esiRNA esiRNA human OR2AK2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004491 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004491 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192598 predicted 570
2 SASI_Hs01_00192599 predicted 708
3 SASI_Hs01_00192600 predicted 521
4 SASI_Hs01_00192601 predicted 297
5 SASI_Hs01_00192602 predicted 412
6 SASI_Hs01_00192603 predicted 772
7 SASI_Hs01_00192604 predicted 304
8 SASI_Hs01_00192605 predicted 500
9 SASI_Hs01_00192606 predicted 344
10 SASI_Hs01_00192607 predicted 692
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004491
OR2AK2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily AK, member 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004491.1-806s1c1
Sequence:CCGGCCACTCTCTTTACCTACACAACTCGAGTTGTGTAGGTAAAGAGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004491.1-430s1c1
Sequence:CCGGCCTTTACATTATCCTATGCTTCTCGAGAAGCATAGGATAATGTAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004491.1-300s1c1
Sequence:CCGGCCTCTCACAGAGTAAGACCATCTCGAGATGGTCTTACTCTGTGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004491.1-162s1c1
Sequence:CCGGGACAGGAAATATCATGCTGATCTCGAGATCAGCATGATATTTCCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004491.1-494s1c1
Sequence:CCGGCCAGTGGTTCTATCAATGCTTCTCGAGAAGCATTGATAGAACCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004491
OR2AK2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily AK, member 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004491.1-806s1c1
Sequence:CCGGCCACTCTCTTTACCTACACAACTCGAGTTGTGTAGGTAAAGAGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004491.1-430s1c1
Sequence:CCGGCCTTTACATTATCCTATGCTTCTCGAGAAGCATAGGATAATGTAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004491.1-300s1c1
Sequence:CCGGCCTCTCACAGAGTAAGACCATCTCGAGATGGTCTTACTCTGTGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004491.1-162s1c1
Sequence:CCGGGACAGGAAATATCATGCTGATCTCGAGATCAGCATGATATTTCCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004491.1-494s1c1
Sequence:CCGGCCAGTGGTTCTATCAATGCTTCTCGAGAAGCATTGATAGAACCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004491
OR2AK2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily AK, member 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004491.1-806s1c1
Sequence:CCGGCCACTCTCTTTACCTACACAACTCGAGTTGTGTAGGTAAAGAGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004491.1-430s1c1
Sequence:CCGGCCTTTACATTATCCTATGCTTCTCGAGAAGCATAGGATAATGTAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004491.1-300s1c1
Sequence:CCGGCCTCTCACAGAGTAAGACCATCTCGAGATGGTCTTACTCTGTGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004491.1-162s1c1
Sequence:CCGGGACAGGAAATATCATGCTGATCTCGAGATCAGCATGATATTTCCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004491.1-494s1c1
Sequence:CCGGCCAGTGGTTCTATCAATGCTTCTCGAGAAGCATTGATAGAACCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)