EMAIL THIS PAGE TO A FRIEND

OR2AT4

olfactory receptor, family 2, subfamily AT, member 4

16 Gene Product Result for
Synonyms: OR11-265
UniProtKB ID: A6NND4, B9EGZ8
Gene ID:
Human(341152) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(530824) olfactory receptor, family 2, subfamily AT, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_291892 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_291892 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_291892 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005285 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005285 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231031 predicted 303
2 SASI_Hs01_00231032 predicted 408
3 SASI_Hs01_00231033 predicted 511
4 SASI_Hs01_00231034 predicted 408
5 SASI_Hs01_00231035 predicted 504
6 SASI_Hs01_00231036 predicted 503
7 SASI_Hs01_00231037 predicted 518
8 SASI_Hs01_00231038 predicted 601
9 SASI_Hs01_00231039 predicted 544
10 SASI_Hs01_00231040 predicted 739
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_291892
OR2AT4 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily AT, member 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291892.2-120s1c1
Sequence:CCGGCCTTCTCATCCTGATGGGTAACTCGAGTTACCCATCAGGATGAGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291892.2-42s1c1
Sequence:CCGGCGTCTTCTATCTATTGGGCATCTCGAGATGCCCAATAGATAGAAGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291892.2-683s1c1
Sequence:CCGGCCTCAGTGCTTCGCATCAGTTCTCGAGAACTGATGCGAAGCACTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291892.2-507s1c1
Sequence:CCGGCCAGATGGCATATAACAGCATCTCGAGATGCTGTTATATGCCATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291892.2-771s1c1
Sequence:CCGGCTCATCTATTGCCATAGCCTACTCGAGTAGGCTATGGCAATAGATGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_291892
OR2AT4 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily AT, member 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291892.2-120s1c1
Sequence:CCGGCCTTCTCATCCTGATGGGTAACTCGAGTTACCCATCAGGATGAGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291892.2-42s1c1
Sequence:CCGGCGTCTTCTATCTATTGGGCATCTCGAGATGCCCAATAGATAGAAGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291892.2-683s1c1
Sequence:CCGGCCTCAGTGCTTCGCATCAGTTCTCGAGAACTGATGCGAAGCACTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291892.2-507s1c1
Sequence:CCGGCCAGATGGCATATAACAGCATCTCGAGATGCTGTTATATGCCATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291892.2-771s1c1
Sequence:CCGGCTCATCTATTGCCATAGCCTACTCGAGTAGGCTATGGCAATAGATGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_291892
OR2AT4 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily AT, member 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291892.2-120s1c1
Sequence:CCGGCCTTCTCATCCTGATGGGTAACTCGAGTTACCCATCAGGATGAGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291892.2-42s1c1
Sequence:CCGGCGTCTTCTATCTATTGGGCATCTCGAGATGCCCAATAGATAGAAGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291892.2-683s1c1
Sequence:CCGGCCTCAGTGCTTCGCATCAGTTCTCGAGAACTGATGCGAAGCACTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291892.2-507s1c1
Sequence:CCGGCCAGATGGCATATAACAGCATCTCGAGATGCTGTTATATGCCATCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_291892.2-771s1c1
Sequence:CCGGCTCATCTATTGCCATAGCCTACTCGAGTAGGCTATGGCAATAGATGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)