EMAIL THIS PAGE TO A FRIEND

OR2B6

olfactory receptor, family 2, subfamily B, member 6

15 Gene Product Result for
Synonyms: OR2B1 OR2B1P OR2B5 OR2B6P OR5-40 OR5-41 OR6-31 dJ408B20.2
UniProtKB ID: P58173, O43883, Q6IF89, Q9H5B0
Gene ID:
Human(26212) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(528374) olfactory receptor, family 2, subfamily B, member 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305972 ANTI-OR2B6(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012367 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012367 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012367 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU112311 MISSION® esiRNA esiRNA human OR2B6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012367 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130311 predicted 674
2 SASI_Hs01_00130312 predicted 230
3 SASI_Hs01_00130313 predicted 667
4 SASI_Hs01_00130314 predicted 221
5 SASI_Hs01_00130317 predicted 598
6 SASI_Hs01_00130318 predicted 470
7 SASI_Hs01_00130319 predicted 433
8 SASI_Hs02_00344166 predicted 237
9 SASI_Hs01_00130315 predicted 581
10 SASI_Hs01_00130316 predicted 507
11 SASI_Hs01_00130320 predicted 518
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012367
OR2B6 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily B, member 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012367.1-589s1c1
Sequence:CCGGGCTGAACTATTCCTTGTCAGTCTCGAGACTGACAAGGAATAGTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012367.1-384s1c1
Sequence:CCGGGCCTCTCCATTACTCAGTTATCTCGAGATAACTGAGTAATGGAGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012367.1-666s1c1
Sequence:CCGGCCGAGCAGTATTGAGGATACACTCGAGTGTATCCTCAATACTGCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012367.1-28s1c1
Sequence:CCGGCAGGAGTTTATTCTGCTGGGTCTCGAGACCCAGCAGAATAAACTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012367.1-547s1c1
Sequence:CCGGGCACTGCTCAAGTTATCTTGTCTCGAGACAAGATAACTTGAGCAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012367
OR2B6 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily B, member 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012367.1-589s1c1
Sequence:CCGGGCTGAACTATTCCTTGTCAGTCTCGAGACTGACAAGGAATAGTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012367.1-384s1c1
Sequence:CCGGGCCTCTCCATTACTCAGTTATCTCGAGATAACTGAGTAATGGAGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012367.1-666s1c1
Sequence:CCGGCCGAGCAGTATTGAGGATACACTCGAGTGTATCCTCAATACTGCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012367.1-28s1c1
Sequence:CCGGCAGGAGTTTATTCTGCTGGGTCTCGAGACCCAGCAGAATAAACTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012367.1-547s1c1
Sequence:CCGGGCACTGCTCAAGTTATCTTGTCTCGAGACAAGATAACTTGAGCAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012367
OR2B6 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily B, member 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012367.1-589s1c1
Sequence:CCGGGCTGAACTATTCCTTGTCAGTCTCGAGACTGACAAGGAATAGTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187993    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012367.1-384s1c1
Sequence:CCGGGCCTCTCCATTACTCAGTTATCTCGAGATAACTGAGTAATGGAGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012367.1-666s1c1
Sequence:CCGGCCGAGCAGTATTGAGGATACACTCGAGTGTATCCTCAATACTGCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012367.1-28s1c1
Sequence:CCGGCAGGAGTTTATTCTGCTGGGTCTCGAGACCCAGCAGAATAAACTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012367.1-547s1c1
Sequence:CCGGGCACTGCTCAAGTTATCTTGTCTCGAGACAAGATAACTTGAGCAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)