EMAIL THIS PAGE TO A FRIEND

OR2C1

olfactory receptor, family 2, subfamily C, member 1

19 Gene Product Result for
Synonyms: OLFmf3 OR2C2P
UniProtKB ID: O95371, A0AVA4, Q6IF34, Q6IF55
Gene ID:
Human(4993) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
dog(490037) olfactory receptor, family 2, subfamily C, member 1
cow(514760) olfactory receptor, family 2, subfamily C, member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502051 Anti-OR2C1 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing
SAB2107433 Anti-OR2C1 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012368 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012368 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012368 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU045081 MISSION® esiRNA esiRNA human OR2C1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012368 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012368 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160212 predicted 679
2 SASI_Hs01_00160214 predicted 323
3 SASI_Hs01_00160216 predicted 512
4 SASI_Hs01_00160217 predicted 512
5 SASI_Hs01_00160215 predicted 623
6 SASI_Hs02_00344167 predicted 813
7 SASI_Hs01_00160218 predicted 282
8 SASI_Hs01_00160219 predicted 699
9 SASI_Hs01_00160220 predicted 339
10 SASI_Hs01_00160221 predicted 758
11 SASI_Hs01_00160213 predicted 212
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012368
OR2C1 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily C, member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012368.1-461s1c1
Sequence:CCGGGCAACTCTGTGATCCAGTCAACTCGAGTTGACTGGATCACAGAGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012368.1-40s1c1
Sequence:CCGGCTGATGAGCATATCGGACCATCTCGAGATGGTCCGATATGCTCATCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012368.2-591s21c1
Sequence:CCGGAGGTGCCTGCCATGATCAAACCTCGAGGTTTGATCATGGCAGGCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012368.1-643s1c1
Sequence:CCGGGTGATCTCCTACTGCCTCATTCTCGAGAATGAGGCAGTAGGAGATCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012368.1-120s1c1
Sequence:CCGGTGGGAACTCAACCATCATCTTCTCGAGAAGATGATGGTTGAGTTCCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012368.1-275s1c1
Sequence:CCGGTCAGCTATGGTGGCTGCATAACTCGAGTTATGCAGCCACCATAGCTGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012368.2-84s21c1
Sequence:CCGGGCTTTGTTCTGATGGGCATATCTCGAGATATGCCCATCAGAACAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012368.2-751s21c1
Sequence:CCGGGAGGCGAAAGGCGTTCAATACCTCGAGGTATTGAACGCCTTTCGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012368.2-518s21c1
Sequence:CCGGTCTGTGATCCAGTCAACATTCCTCGAGGAATGTTGACTGGATCACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012368
OR2C1 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily C, member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012368.1-461s1c1
Sequence:CCGGGCAACTCTGTGATCCAGTCAACTCGAGTTGACTGGATCACAGAGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012368.1-40s1c1
Sequence:CCGGCTGATGAGCATATCGGACCATCTCGAGATGGTCCGATATGCTCATCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012368.2-591s21c1
Sequence:CCGGAGGTGCCTGCCATGATCAAACCTCGAGGTTTGATCATGGCAGGCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012368.1-643s1c1
Sequence:CCGGGTGATCTCCTACTGCCTCATTCTCGAGAATGAGGCAGTAGGAGATCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012368.1-120s1c1
Sequence:CCGGTGGGAACTCAACCATCATCTTCTCGAGAAGATGATGGTTGAGTTCCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012368.1-275s1c1
Sequence:CCGGTCAGCTATGGTGGCTGCATAACTCGAGTTATGCAGCCACCATAGCTGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012368.2-84s21c1
Sequence:CCGGGCTTTGTTCTGATGGGCATATCTCGAGATATGCCCATCAGAACAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012368.2-751s21c1
Sequence:CCGGGAGGCGAAAGGCGTTCAATACCTCGAGGTATTGAACGCCTTTCGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012368.2-518s21c1
Sequence:CCGGTCTGTGATCCAGTCAACATTCCTCGAGGAATGTTGACTGGATCACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012368
OR2C1 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily C, member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012368.1-461s1c1
Sequence:CCGGGCAACTCTGTGATCCAGTCAACTCGAGTTGACTGGATCACAGAGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012368.1-40s1c1
Sequence:CCGGCTGATGAGCATATCGGACCATCTCGAGATGGTCCGATATGCTCATCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357818    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012368.2-591s21c1
Sequence:CCGGAGGTGCCTGCCATGATCAAACCTCGAGGTTTGATCATGGCAGGCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012368.1-643s1c1
Sequence:CCGGGTGATCTCCTACTGCCTCATTCTCGAGAATGAGGCAGTAGGAGATCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012368.1-120s1c1
Sequence:CCGGTGGGAACTCAACCATCATCTTCTCGAGAAGATGATGGTTGAGTTCCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012368.1-275s1c1
Sequence:CCGGTCAGCTATGGTGGCTGCATAACTCGAGTTATGCAGCCACCATAGCTGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012368.2-84s21c1
Sequence:CCGGGCTTTGTTCTGATGGGCATATCTCGAGATATGCCCATCAGAACAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012368.2-751s21c1
Sequence:CCGGGAGGCGAAAGGCGTTCAATACCTCGAGGTATTGAACGCCTTTCGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357820    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012368.2-518s21c1
Sequence:CCGGTCTGTGATCCAGTCAACATTCCTCGAGGAATGTTGACTGGATCACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)