EMAIL THIS PAGE TO A FRIEND

OR2G2

olfactory receptor, family 2, subfamily G, member 2

15 Gene Product Result for
Synonyms: OR1-32
UniProtKB ID: Q8NGZ5, Q5JQT2, Q6IEZ0
Gene ID:
Human(81470) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(511266) olfactory receptor, family 2, subfamily G, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503237 Anti-OR2G2 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001915 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001915 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001915 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150061 MISSION® esiRNA esiRNA human OR2G2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001915 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213473 predicted 283
2 SASI_Hs01_00213474 predicted 475
3 SASI_Hs01_00213475 predicted 438
4 SASI_Hs01_00213476 predicted 399
5 SASI_Hs01_00213477 predicted 288
6 SASI_Hs01_00213478 predicted 280
7 SASI_Hs02_00303989 predicted 386
8 SASI_Hs01_00213479 predicted 408
9 SASI_Hs01_00213480 predicted 212
10 SASI_Hs01_00213482 predicted 389
11 SASI_Hs01_00213481 predicted 530
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001915
OR2G2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily G, member 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001915.1-394s1c1
Sequence:CCGGCCTCTCCATTACACTGTCTTACTCGAGTAAGACAGTGTAATGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001915.1-70s1c1
Sequence:CCGGCCTCAGTTACAGAAGGTTCTACTCGAGTAGAACCTTCTGTAACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001915.1-293s1c1
Sequence:CCGGGTGGCTGTTTGGTTCACCTTTCTCGAGAAAGGTGAACCAAACAGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001915.1-742s1c1
Sequence:CCGGCTGACAGTGGTCACCATCTTTCTCGAGAAAGATGGTGACCACTGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001915.1-519s1c1
Sequence:CCGGGCATCGCCAAGTGGATCATTTCTCGAGAAATGATCCACTTGGCGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001915
OR2G2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily G, member 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001915.1-394s1c1
Sequence:CCGGCCTCTCCATTACACTGTCTTACTCGAGTAAGACAGTGTAATGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001915.1-70s1c1
Sequence:CCGGCCTCAGTTACAGAAGGTTCTACTCGAGTAGAACCTTCTGTAACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001915.1-293s1c1
Sequence:CCGGGTGGCTGTTTGGTTCACCTTTCTCGAGAAAGGTGAACCAAACAGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001915.1-742s1c1
Sequence:CCGGCTGACAGTGGTCACCATCTTTCTCGAGAAAGATGGTGACCACTGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001915.1-519s1c1
Sequence:CCGGGCATCGCCAAGTGGATCATTTCTCGAGAAATGATCCACTTGGCGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001915
OR2G2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily G, member 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001915.1-394s1c1
Sequence:CCGGCCTCTCCATTACACTGTCTTACTCGAGTAAGACAGTGTAATGGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001915.1-70s1c1
Sequence:CCGGCCTCAGTTACAGAAGGTTCTACTCGAGTAGAACCTTCTGTAACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001915.1-293s1c1
Sequence:CCGGGTGGCTGTTTGGTTCACCTTTCTCGAGAAAGGTGAACCAAACAGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001915.1-742s1c1
Sequence:CCGGCTGACAGTGGTCACCATCTTTCTCGAGAAAGATGGTGACCACTGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001915.1-519s1c1
Sequence:CCGGGCATCGCCAAGTGGATCATTTCTCGAGAAATGATCCACTTGGCGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)