EMAIL THIS PAGE TO A FRIEND

OR2G3

olfactory receptor, family 2, subfamily G, member 3

16 Gene Product Result for
Synonyms: OR1-33
UniProtKB ID: Q8NGZ4, B2RN64, Q5JQT1, Q6IF45
Gene ID:
Human(81469) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(614762) olfactory receptor, family 2, subfamily G, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1304371 ANTI-OR2G3 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4503236 Anti-OR2G3 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001914 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001914 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001914 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001914 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303987 predicted 627
2 SASI_Hs01_00059874 predicted 572
3 SASI_Hs01_00059875 predicted 239
4 SASI_Hs01_00059876 predicted 421
5 SASI_Hs01_00059877 predicted 506
6 SASI_Hs01_00059878 predicted 220
7 SASI_Hs01_00059879 predicted 576
8 SASI_Hs01_00059880 predicted 655
9 SASI_Hs01_00059881 predicted 282
10 SASI_Hs02_00303988 predicted 630
11 SASI_Hs01_00059882 predicted 415
12 SASI_Hs01_00059883 predicted 508
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001914
OR2G3 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily G, member 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001914.1-364s1c1
Sequence:CCGGCGGTACATTGCTGTCTGCAAACTCGAGTTTGCAGACAGCAATGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001914.1-129s1c1
Sequence:CCGGCACCATAATCATCATCTCATACTCGAGTATGAGATGATGATTATGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001914.1-578s1c1
Sequence:CCGGCTGTCAATGAATTGGTGCTTTCTCGAGAAAGCACCAATTCATTGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001914.1-634s1c1
Sequence:CCGGGCACTCATCTCCATCTCCTATCTCGAGATAGGAGATGGAGATGAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001914.1-255s1c1
Sequence:CCGGGCAAAGACCAAAGAAGACGATCTCGAGATCGTCTTCTTTGGTCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001914
OR2G3 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily G, member 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001914.1-364s1c1
Sequence:CCGGCGGTACATTGCTGTCTGCAAACTCGAGTTTGCAGACAGCAATGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001914.1-129s1c1
Sequence:CCGGCACCATAATCATCATCTCATACTCGAGTATGAGATGATGATTATGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001914.1-578s1c1
Sequence:CCGGCTGTCAATGAATTGGTGCTTTCTCGAGAAAGCACCAATTCATTGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001914.1-634s1c1
Sequence:CCGGGCACTCATCTCCATCTCCTATCTCGAGATAGGAGATGGAGATGAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001914.1-255s1c1
Sequence:CCGGGCAAAGACCAAAGAAGACGATCTCGAGATCGTCTTCTTTGGTCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001914
OR2G3 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily G, member 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001914.1-364s1c1
Sequence:CCGGCGGTACATTGCTGTCTGCAAACTCGAGTTTGCAGACAGCAATGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001914.1-129s1c1
Sequence:CCGGCACCATAATCATCATCTCATACTCGAGTATGAGATGATGATTATGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001914.1-578s1c1
Sequence:CCGGCTGTCAATGAATTGGTGCTTTCTCGAGAAAGCACCAATTCATTGACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001914.1-634s1c1
Sequence:CCGGGCACTCATCTCCATCTCCTATCTCGAGATAGGAGATGGAGATGAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001914.1-255s1c1
Sequence:CCGGGCAAAGACCAAAGAAGACGATCTCGAGATCGTCTTCTTTGGTCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)