EMAIL THIS PAGE TO A FRIEND

OR2H2

olfactory receptor, family 2, subfamily H, member 2

16 Gene Product Result for
Synonyms: FAT11 OLFR2 OLFR42B OR2H3 dJ271M21.2 hs6M1-12
Species: Human OR2H2(7932)
Gene ID:
Human(7932) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503149 Anti-OR2H2, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007160 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007160 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007160 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007160 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172551 predicted 565
2 SASI_Hs01_00172552 predicted 471
3 SASI_Hs01_00172554 predicted 239
4 SASI_Hs01_00172555 predicted 675
5 SASI_Hs01_00172557 predicted 592
6 SASI_Hs01_00172558 predicted 490
7 SASI_Hs01_00172559 predicted 597
8 SASI_Hs01_00172560 predicted 592
9 SASI_Hs02_00343091 predicted 626
10 SASI_Hs02_00343092 predicted 480
11 SASI_Hs01_00172553 predicted 627
12 SASI_Hs01_00172556 predicted 375
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007160
OR2H2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily H, member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007160.2-659s1c1
Sequence:CCGGCCTGGGCAGTGCTGAGGATTACTCGAGTAATCCTCAGCACTGCCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007160.3-133s21c1
Sequence:CCGGTCCTACCTCCTAACCCTAGTGCTCGAGCACTAGGGTTAGGAGGTAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007160.2-205s1c1
Sequence:CCGGCTCTGTTTCACCACGAGTTGTCTCGAGACAACTCGTGGTGAAACAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007160.2-91s1c1
Sequence:CCGGACTTCCTACCTCCTAACCCTACTCGAGTAGGGTTAGGAGGTAGGAAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007160.2-741s1c1
Sequence:CCGGCCTCTTCTACAGCTCAGTCATCTCGAGATGACTGAGCTGTAGAAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007160.3-543s21c1
Sequence:CCGGCGATCGGCAGGTGGATGATTTCTCGAGAAATCATCCACCTGCCGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007160.3-677s21c1
Sequence:CCGGTTGTCTCTTACGGAGCCATTACTCGAGTAATGGCTCCGTAAGAGACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007160.2-637s1c1
Sequence:CCGGCTTGTCTCTTACGGAGCCATTCTCGAGAATGGCTCCGTAAGAGACAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007160.3-567s21c1
Sequence:CCGGCTGTGAGGTCCCAGCTCTAATCTCGAGATTAGAGCTGGGACCTCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007160
OR2H2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily H, member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007160.2-659s1c1
Sequence:CCGGCCTGGGCAGTGCTGAGGATTACTCGAGTAATCCTCAGCACTGCCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007160.3-133s21c1
Sequence:CCGGTCCTACCTCCTAACCCTAGTGCTCGAGCACTAGGGTTAGGAGGTAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007160.2-205s1c1
Sequence:CCGGCTCTGTTTCACCACGAGTTGTCTCGAGACAACTCGTGGTGAAACAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007160.2-91s1c1
Sequence:CCGGACTTCCTACCTCCTAACCCTACTCGAGTAGGGTTAGGAGGTAGGAAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007160.2-741s1c1
Sequence:CCGGCCTCTTCTACAGCTCAGTCATCTCGAGATGACTGAGCTGTAGAAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007160.3-543s21c1
Sequence:CCGGCGATCGGCAGGTGGATGATTTCTCGAGAAATCATCCACCTGCCGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007160.3-677s21c1
Sequence:CCGGTTGTCTCTTACGGAGCCATTACTCGAGTAATGGCTCCGTAAGAGACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007160.2-637s1c1
Sequence:CCGGCTTGTCTCTTACGGAGCCATTCTCGAGAATGGCTCCGTAAGAGACAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007160.3-567s21c1
Sequence:CCGGCTGTGAGGTCCCAGCTCTAATCTCGAGATTAGAGCTGGGACCTCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007160
OR2H2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily H, member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007160.2-659s1c1
Sequence:CCGGCCTGGGCAGTGCTGAGGATTACTCGAGTAATCCTCAGCACTGCCCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007160.3-133s21c1
Sequence:CCGGTCCTACCTCCTAACCCTAGTGCTCGAGCACTAGGGTTAGGAGGTAGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007160.2-205s1c1
Sequence:CCGGCTCTGTTTCACCACGAGTTGTCTCGAGACAACTCGTGGTGAAACAGAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007160.2-91s1c1
Sequence:CCGGACTTCCTACCTCCTAACCCTACTCGAGTAGGGTTAGGAGGTAGGAAGTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007160.2-741s1c1
Sequence:CCGGCCTCTTCTACAGCTCAGTCATCTCGAGATGACTGAGCTGTAGAAGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007160.3-543s21c1
Sequence:CCGGCGATCGGCAGGTGGATGATTTCTCGAGAAATCATCCACCTGCCGATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007160.3-677s21c1
Sequence:CCGGTTGTCTCTTACGGAGCCATTACTCGAGTAATGGCTCCGTAAGAGACAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007160.2-637s1c1
Sequence:CCGGCTTGTCTCTTACGGAGCCATTCTCGAGAATGGCTCCGTAAGAGACAAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007160.3-567s21c1
Sequence:CCGGCTGTGAGGTCCCAGCTCTAATCTCGAGATTAGAGCTGGGACCTCACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)