EMAIL THIS PAGE TO A FRIEND

OR2L13

olfactory receptor, family 2, subfamily L, member 13

19 Gene Product Result for
Synonyms: OR2L14
UniProtKB ID: Q8N349, Q5VUR5
Gene ID:
Human(284521) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(506034) olfactory receptor, family 2, subfamily L, member 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301646 ANTI-OR2L13 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175911 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175911 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175911 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU044351 MISSION® esiRNA esiRNA human OR2L13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175911 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154864 predicted 340
2 SASI_Hs01_00154865 predicted 996
3 SASI_Hs01_00154866 predicted 462
4 SASI_Hs01_00154867 predicted 346
5 SASI_Hs01_00154868 predicted 421
6 SASI_Hs01_00154869 predicted 389
7 SASI_Hs01_00154870 predicted 531
8 SASI_Hs01_00154871 predicted 452
9 SASI_Hs01_00154872 predicted 347
10 SASI_Hs01_00154873 predicted 882
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175911
OR2L13 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily L, member 13
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175911.2-1048s1c1
Sequence:CCGGCACCACCATTTCAACACATTTCTCGAGAAATGTGTTGAAATGGTGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175911.2-1706s1c1
Sequence:CCGGGCCCAGTAGTCAGTGTCTATACTCGAGTATAGACACTGACTACTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175911.2-391s1c1
Sequence:CCGGCCCAAATCAAACTGGAATATTCTCGAGAATATTCCAGTTTGATTTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175911.2-685s21c1
Sequence:CCGGCATGGCCTACGACCGTTATTTCTCGAGAAATAACGGTCGTAGGCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175911.2-983s21c1
Sequence:CCGGTCCTGTGGCCGAGTCCTATTTCTCGAGAAATAGGACTCGGCCACAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175911.2-991s1c1
Sequence:CCGGCCGAGTCCTATTTGCTGTCTACTCGAGTAGACAGCAAATAGGACTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175911.2-715s1c1
Sequence:CCGGCCACTCTCTCTATTATCCTATCTCGAGATAGGATAATAGAGAGAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175911.2-844s21c1
Sequence:CCGGGTCTAGGGCTATTGACCATTTCTCGAGAAATGGTCAATAGCCCTAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175911
OR2L13 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily L, member 13
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175911.2-1048s1c1
Sequence:CCGGCACCACCATTTCAACACATTTCTCGAGAAATGTGTTGAAATGGTGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175911.2-1706s1c1
Sequence:CCGGGCCCAGTAGTCAGTGTCTATACTCGAGTATAGACACTGACTACTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175911.2-391s1c1
Sequence:CCGGCCCAAATCAAACTGGAATATTCTCGAGAATATTCCAGTTTGATTTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175911.2-685s21c1
Sequence:CCGGCATGGCCTACGACCGTTATTTCTCGAGAAATAACGGTCGTAGGCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175911.2-983s21c1
Sequence:CCGGTCCTGTGGCCGAGTCCTATTTCTCGAGAAATAGGACTCGGCCACAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175911.2-991s1c1
Sequence:CCGGCCGAGTCCTATTTGCTGTCTACTCGAGTAGACAGCAAATAGGACTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175911.2-715s1c1
Sequence:CCGGCCACTCTCTCTATTATCCTATCTCGAGATAGGATAATAGAGAGAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175911.2-844s21c1
Sequence:CCGGGTCTAGGGCTATTGACCATTTCTCGAGAAATGGTCAATAGCCCTAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175911
OR2L13 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily L, member 13
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175911.2-1048s1c1
Sequence:CCGGCACCACCATTTCAACACATTTCTCGAGAAATGTGTTGAAATGGTGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175911.2-1706s1c1
Sequence:CCGGGCCCAGTAGTCAGTGTCTATACTCGAGTATAGACACTGACTACTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175911.2-391s1c1
Sequence:CCGGCCCAAATCAAACTGGAATATTCTCGAGAATATTCCAGTTTGATTTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175911.2-685s21c1
Sequence:CCGGCATGGCCTACGACCGTTATTTCTCGAGAAATAACGGTCGTAGGCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175911.2-983s21c1
Sequence:CCGGTCCTGTGGCCGAGTCCTATTTCTCGAGAAATAGGACTCGGCCACAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175911.2-991s1c1
Sequence:CCGGCCGAGTCCTATTTGCTGTCTACTCGAGTAGACAGCAAATAGGACTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175911.2-715s1c1
Sequence:CCGGCCACTCTCTCTATTATCCTATCTCGAGATAGGATAATAGAGAGAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175911.2-844s21c1
Sequence:CCGGGTCTAGGGCTATTGACCATTTCTCGAGAAATGGTCAATAGCCCTAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)