EMAIL THIS PAGE TO A FRIEND

OR2M2

olfactory receptor, family 2, subfamily M, member 2

14 Gene Product Result for
Synonyms: OR2M2Q OST423
Species: Human OR2M2(391194)
UniProtKB ID: Q96R28, A3KFT4
Gene ID:
Human(391194) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372825 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372825 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372825 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU117451 MISSION® esiRNA esiRNA human OR2M2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004688 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004688 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228374 predicted 420
2 SASI_Hs01_00228375 predicted 394
3 SASI_Hs01_00228376 predicted 701
4 SASI_Hs01_00228377 predicted 937
5 SASI_Hs01_00228378 predicted 971
6 SASI_Hs01_00228379 predicted 930
7 SASI_Hs01_00228380 predicted 963
8 SASI_Hs01_00228381 predicted 962
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372825
OR2M2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily M, member 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372825.2-1989s1c1
Sequence:CCGGCCTACTAATCCTCTCATGCAACTCGAGTTGCATGAGAGGATTAGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372825.2-2098s1c1
Sequence:CCGGCGAGTTATTCTGGCTGTCATTCTCGAGAATGACAGCCAGAATAACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372825.2-2074s1c1
Sequence:CCGGGCAATCATCATTGCTTCCTATCTCGAGATAGGAAGCAATGATGATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372825.2-2045s1c1
Sequence:CCGGGCTGTATAGTAATGCTTGTTTCTCGAGAAACAAGCATTACTATACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372825.2-1507s1c1
Sequence:CCGGCCACACACGTTCCTCTTCTTTCTCGAGAAAGAAGAGGAACGTGTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372825.2-1821s1c1
Sequence:CCGGCCACCCTCTAAGATATACCAACTCGAGTTGGTATATCTTAGAGGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372825
OR2M2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily M, member 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372825.2-1989s1c1
Sequence:CCGGCCTACTAATCCTCTCATGCAACTCGAGTTGCATGAGAGGATTAGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372825.2-2098s1c1
Sequence:CCGGCGAGTTATTCTGGCTGTCATTCTCGAGAATGACAGCCAGAATAACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372825.2-2074s1c1
Sequence:CCGGGCAATCATCATTGCTTCCTATCTCGAGATAGGAAGCAATGATGATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000185483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372825.2-2045s1c1
Sequence:CCGGGCTGTATAGTAATGCTTGTTTCTCGAGAAACAAGCATTACTATACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372825.2-1507s1c1
Sequence:CCGGCCACACACGTTCCTCTTCTTTCTCGAGAAAGAAGAGGAACGTGTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372825.2-1821s1c1
Sequence:CCGGCCACCCTCTAAGATATACCAACTCGAGTTGGTATATCTTAGAGGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372825
OR2M2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily M, member 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372825.2-1989s1c1
Sequence:CCGGCCTACTAATCCTCTCATGCAACTCGAGTTGCATGAGAGGATTAGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372825.2-2098s1c1
Sequence:CCGGCGAGTTATTCTGGCTGTCATTCTCGAGAATGACAGCCAGAATAACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372825.2-2074s1c1
Sequence:CCGGGCAATCATCATTGCTTCCTATCTCGAGATAGGAAGCAATGATGATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000185483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372825.2-2045s1c1
Sequence:CCGGGCTGTATAGTAATGCTTGTTTCTCGAGAAACAAGCATTACTATACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372825.2-1507s1c1
Sequence:CCGGCCACACACGTTCCTCTTCTTTCTCGAGAAAGAAGAGGAACGTGTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372825.2-1821s1c1
Sequence:CCGGCCACCCTCTAAGATATACCAACTCGAGTTGGTATATCTTAGAGGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)