EMAIL THIS PAGE TO A FRIEND

OR2M4

olfactory receptor, family 2, subfamily M, member 4

17 Gene Product Result for
Synonyms: HSHTPCRX18 HTPCRX18 OR1-55 OST710 TPCR100
UniProtKB ID: Q96R27, Q15611, Q8NG82
Gene ID:
Human(26245) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(539568) olfactory receptor, family 2, subfamily M, member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017504 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017504 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017504 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_371358 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371358 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371358 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017504 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017504 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169995 predicted 450
2 SASI_Hs01_00169996 predicted 390
3 SASI_Hs01_00169997 predicted 508
4 SASI_Hs01_00169998 predicted 628
5 SASI_Hs01_00169999 predicted 608
6 SASI_Hs02_00350115 predicted 404
7 SASI_Hs02_00350116 predicted 574
8 SASI_Hs02_00350117 predicted 247
9 SASI_Hs01_00170000 predicted 283
10 SASI_Hs01_00170001 predicted 291
11 SASI_Hs01_00170002 predicted 279
12 SASI_Hs01_00170003 predicted 297
13 SASI_Hs01_00170004 predicted 299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017504
OR2M4 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily M, member 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017504.1-584s21c1
Sequence:CCGGTTGAAAGACTACTTGTCATTTCTCGAGAAATGACAAGTAGTCTTTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017504.1-478s21c1
Sequence:CCGGCTTGCAGCTGTCCTGTCATTTCTCGAGAAATGACAGGACAGCTGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017504.1-134s21c1
Sequence:CCGGTGGTTCTCCTCATCTACATAGCTCGAGCTATGTAGATGAGGAGAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017504.1-286s21c1
Sequence:CCGGGGTTGTGGAACTCAGATATTCCTCGAGGAATATCTGAGTTCCACAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017504.1-392s21c1
Sequence:CCGGAGTACACCATCCTCATGAATCCTCGAGGATTCATGAGGATGGTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017504.1-630s21c1
Sequence:CCGGAGTTTCAGTTATCATACTTTCCTCGAGGAAAGTATGATAACTGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017504.1-608s21c1
Sequence:CCGGGTGTGGTAATGCTAATCTTTCCTCGAGGAAAGATTAGCATTACCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017504
OR2M4 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily M, member 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017504.1-584s21c1
Sequence:CCGGTTGAAAGACTACTTGTCATTTCTCGAGAAATGACAAGTAGTCTTTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017504.1-478s21c1
Sequence:CCGGCTTGCAGCTGTCCTGTCATTTCTCGAGAAATGACAGGACAGCTGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017504.1-134s21c1
Sequence:CCGGTGGTTCTCCTCATCTACATAGCTCGAGCTATGTAGATGAGGAGAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017504.1-286s21c1
Sequence:CCGGGGTTGTGGAACTCAGATATTCCTCGAGGAATATCTGAGTTCCACAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017504.1-392s21c1
Sequence:CCGGAGTACACCATCCTCATGAATCCTCGAGGATTCATGAGGATGGTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017504.1-630s21c1
Sequence:CCGGAGTTTCAGTTATCATACTTTCCTCGAGGAAAGTATGATAACTGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017504.1-608s21c1
Sequence:CCGGGTGTGGTAATGCTAATCTTTCCTCGAGGAAAGATTAGCATTACCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017504
OR2M4 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily M, member 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017504.1-584s21c1
Sequence:CCGGTTGAAAGACTACTTGTCATTTCTCGAGAAATGACAAGTAGTCTTTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017504.1-478s21c1
Sequence:CCGGCTTGCAGCTGTCCTGTCATTTCTCGAGAAATGACAGGACAGCTGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017504.1-134s21c1
Sequence:CCGGTGGTTCTCCTCATCTACATAGCTCGAGCTATGTAGATGAGGAGAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017504.1-286s21c1
Sequence:CCGGGGTTGTGGAACTCAGATATTCCTCGAGGAATATCTGAGTTCCACAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017504.1-392s21c1
Sequence:CCGGAGTACACCATCCTCATGAATCCTCGAGGATTCATGAGGATGGTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017504.1-630s21c1
Sequence:CCGGAGTTTCAGTTATCATACTTTCCTCGAGGAAAGTATGATAACTGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017504.1-608s21c1
Sequence:CCGGGTGTGGTAATGCTAATCTTTCCTCGAGGAAAGATTAGCATTACCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371358
OR2M4 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily M, member 4
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000188617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371358.1-283s1c1
Sequence:CCGGGCAGGTTGTGGAACTCAGATACTCGAGTATCTGAGTTCCACAACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371358.1-251s1c1
Sequence:CCGGGCTACTTGTCTGGGAAGAAATCTCGAGATTTCTTCCCAGACAAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371358.1-186s1c1
Sequence:CCGGCCTCAGTCAACTGTCCCTTATCTCGAGATAAGGGACAGTTGACTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371358.1-139s1c1
Sequence:CCGGCTCCTCATCTACATAGAGAAACTCGAGTTTCTCTATGTAGATGAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371358
OR2M4 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily M, member 4
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000188617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371358.1-283s1c1
Sequence:CCGGGCAGGTTGTGGAACTCAGATACTCGAGTATCTGAGTTCCACAACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371358.1-251s1c1
Sequence:CCGGGCTACTTGTCTGGGAAGAAATCTCGAGATTTCTTCCCAGACAAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371358.1-186s1c1
Sequence:CCGGCCTCAGTCAACTGTCCCTTATCTCGAGATAAGGGACAGTTGACTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000203344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371358.1-139s1c1
Sequence:CCGGCTCCTCATCTACATAGAGAAACTCGAGTTTCTCTATGTAGATGAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371358
OR2M4 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily M, member 4
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000188617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371358.1-283s1c1
Sequence:CCGGGCAGGTTGTGGAACTCAGATACTCGAGTATCTGAGTTCCACAACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371358.1-251s1c1
Sequence:CCGGGCTACTTGTCTGGGAAGAAATCTCGAGATTTCTTCCCAGACAAGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371358.1-186s1c1
Sequence:CCGGCCTCAGTCAACTGTCCCTTATCTCGAGATAAGGGACAGTTGACTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000203344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371358.1-139s1c1
Sequence:CCGGCTCCTCATCTACATAGAGAAACTCGAGTTTCTCTATGTAGATGAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)