EMAIL THIS PAGE TO A FRIEND

OR2M7

olfactory receptor, family 2, subfamily M, member 7

9 Gene Product Result for
Synonyms: OR1-58
Species: Human OR2M7(391196)
UniProtKB ID: Q8NG81, B2RNL0, Q6IEX6
Gene ID:
Human(391196) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303930 ANTI-OR2M7 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4501725 Anti-OR2M7 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372827 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372827 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372827 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149161 MISSION® esiRNA esiRNA human OR2M7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004691 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004691 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021540 predicted 885
2 SASI_Hs01_00021541 predicted 766
3 SASI_Hs01_00021542 predicted 762
4 SASI_Hs01_00021543 predicted 123
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372827
OR2M7 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily M, member 7
Human
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000187919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372827.1-760s1c1
Sequence:CCGGGCAGGTTTGTTCATGTGCATTCTCGAGAATGCACATGAACAAACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372827
OR2M7 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily M, member 7
Human
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000187919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372827.1-760s1c1
Sequence:CCGGGCAGGTTTGTTCATGTGCATTCTCGAGAATGCACATGAACAAACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372827
OR2M7 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily M, member 7
Human
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000187919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372827.1-760s1c1
Sequence:CCGGGCAGGTTTGTTCATGTGCATTCTCGAGAATGCACATGAACAAACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)