EMAIL THIS PAGE TO A FRIEND

OR2S2

olfactory receptor, family 2, subfamily S, member 2

19 Gene Product Result for
Synonyms: OR37A OST715
UniProtKB ID: Q9NQN1, Q2M3L0, Q6IF19, Q96R42
Gene ID:
Human(56656) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(509916) olfactory receptor, family 2, subfamily S, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301163 ANTI-OR2S1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019897 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019897 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019897 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019897 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019897 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103546 predicted 588
2 SASI_Hs01_00103547 predicted 620
3 SASI_Hs01_00103549 predicted 443
4 SASI_Hs02_00352923 predicted 293
5 SASI_Hs01_00103550 predicted 580
6 SASI_Hs02_00352924 predicted 815
7 SASI_Hs02_00352925 predicted 799
8 SASI_Hs01_00103551 predicted 388
9 SASI_Hs01_00103552 predicted 664
10 SASI_Hs01_00103553 predicted 527
11 SASI_Hs01_00103548 predicted 554
12 SASI_Hs01_00103554 predicted 486
13 SASI_Hs01_00103555 predicted 566
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019897
OR2S2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily S, member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019897.1-600s1c1
Sequence:CCGGCCCGGTTCTGTTCATCTCTTTCTCGAGAAAGAGATGAACAGAACCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019897.1-756s1c1
Sequence:CCGGGCCTAAGTCTAAGGACTCCATCTCGAGATGGAGTCCTTAGACTTAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019897.1-779s1c1
Sequence:CCGGGAGCAGACAAAGAGGATCTTTCTCGAGAAAGATCCTCTTTGTCTGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019897.1-316s1c1
Sequence:CCGGCTGAGCATGATGGCATTTGATCTCGAGATCAAATGCCATCATGCTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019897.1-66s1c1
Sequence:CCGGCCTGCTGATGTACCTCGTGATCTCGAGATCACGAGGTACATCAGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019897.2-596s21c1
Sequence:CCGGTGAGATTCTGGCTGTTCTAAACTCGAGTTTAGAACAGCCAGAATCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019897.2-866s21c1
Sequence:CCGGAGCAGACAAAGAGGATCTTTCCTCGAGGAAAGATCCTCTTTGTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019897.2-834s21c1
Sequence:CCGGTATGGGAAGCCTAAGTCTAAGCTCGAGCTTAGACTTAGGCTTCCCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019897.2-805s21c1
Sequence:CCGGTCGTCTTCTACGGGACCTTATCTCGAGATAAGGTCCCGTAGAAGACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019897
OR2S2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily S, member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019897.1-600s1c1
Sequence:CCGGCCCGGTTCTGTTCATCTCTTTCTCGAGAAAGAGATGAACAGAACCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019897.1-756s1c1
Sequence:CCGGGCCTAAGTCTAAGGACTCCATCTCGAGATGGAGTCCTTAGACTTAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019897.1-779s1c1
Sequence:CCGGGAGCAGACAAAGAGGATCTTTCTCGAGAAAGATCCTCTTTGTCTGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019897.1-316s1c1
Sequence:CCGGCTGAGCATGATGGCATTTGATCTCGAGATCAAATGCCATCATGCTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019897.1-66s1c1
Sequence:CCGGCCTGCTGATGTACCTCGTGATCTCGAGATCACGAGGTACATCAGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019897.2-596s21c1
Sequence:CCGGTGAGATTCTGGCTGTTCTAAACTCGAGTTTAGAACAGCCAGAATCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019897.2-866s21c1
Sequence:CCGGAGCAGACAAAGAGGATCTTTCCTCGAGGAAAGATCCTCTTTGTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019897.2-834s21c1
Sequence:CCGGTATGGGAAGCCTAAGTCTAAGCTCGAGCTTAGACTTAGGCTTCCCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019897.2-805s21c1
Sequence:CCGGTCGTCTTCTACGGGACCTTATCTCGAGATAAGGTCCCGTAGAAGACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019897
OR2S2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily S, member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019897.1-600s1c1
Sequence:CCGGCCCGGTTCTGTTCATCTCTTTCTCGAGAAAGAGATGAACAGAACCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019897.1-756s1c1
Sequence:CCGGGCCTAAGTCTAAGGACTCCATCTCGAGATGGAGTCCTTAGACTTAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019897.1-779s1c1
Sequence:CCGGGAGCAGACAAAGAGGATCTTTCTCGAGAAAGATCCTCTTTGTCTGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019897.1-316s1c1
Sequence:CCGGCTGAGCATGATGGCATTTGATCTCGAGATCAAATGCCATCATGCTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019897.1-66s1c1
Sequence:CCGGCCTGCTGATGTACCTCGTGATCTCGAGATCACGAGGTACATCAGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019897.2-596s21c1
Sequence:CCGGTGAGATTCTGGCTGTTCTAAACTCGAGTTTAGAACAGCCAGAATCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019897.2-866s21c1
Sequence:CCGGAGCAGACAAAGAGGATCTTTCCTCGAGGAAAGATCCTCTTTGTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019897.2-834s21c1
Sequence:CCGGTATGGGAAGCCTAAGTCTAAGCTCGAGCTTAGACTTAGGCTTCCCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019897.2-805s21c1
Sequence:CCGGTCGTCTTCTACGGGACCTTATCTCGAGATAAGGTCCCGTAGAAGACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)