EMAIL THIS PAGE TO A FRIEND

OR2T10

olfactory receptor, family 2, subfamily T, member 10

18 Gene Product Result for
Synonyms: OR1-64
Species: Human OR2T10(127069)
UniProtKB ID: Q8NGZ9, B2RNK7
Gene ID:
Human(127069) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004693 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004693 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004693 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004693 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126274 predicted 623
2 SASI_Hs01_00126275 predicted 399
3 SASI_Hs01_00126277 predicted 506
4 SASI_Hs01_00126278 predicted 644
5 SASI_Hs01_00126279 predicted 382
6 SASI_Hs01_00126280 predicted 627
7 SASI_Hs01_00126282 predicted 497
8 SASI_Hs01_00126283 predicted 559
9 SASI_Hs02_00304647 predicted 663
10 SASI_Hs02_00304648 predicted 412
11 SASI_Hs01_00126276 predicted 606
12 SASI_Hs01_00126281 predicted 210
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004693
OR2T10 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily T, member 10
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004693.1-83s1c1
Sequence:CCGGGCTTGCTTATCTTCAGTATATCTCGAGATATACTGAAGATAAGCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004693.1-513s1c1
Sequence:CCGGCCATGAGATTCAGCACTTCTTCTCGAGAAGAAGTGCTGAATCTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004693.1-633s1c1
Sequence:CCGGGACGGTCATTTCAGTGTCTTACTCGAGTAAGACACTGAAATGACCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004693.1-759s1c1
Sequence:CCGGAGCTGCTATTTACAACTACATCTCGAGATGTAGTTGTAAATAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004693.1-192s1c1
Sequence:CCGGCCAGCTCTCACTCATAGACTTCTCGAGAAGTCTATGAGTGAGAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004693
OR2T10 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily T, member 10
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004693.1-83s1c1
Sequence:CCGGGCTTGCTTATCTTCAGTATATCTCGAGATATACTGAAGATAAGCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004693.1-513s1c1
Sequence:CCGGCCATGAGATTCAGCACTTCTTCTCGAGAAGAAGTGCTGAATCTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004693.1-633s1c1
Sequence:CCGGGACGGTCATTTCAGTGTCTTACTCGAGTAAGACACTGAAATGACCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004693.1-759s1c1
Sequence:CCGGAGCTGCTATTTACAACTACATCTCGAGATGTAGTTGTAAATAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004693.1-192s1c1
Sequence:CCGGCCAGCTCTCACTCATAGACTTCTCGAGAAGTCTATGAGTGAGAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004693
OR2T10 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily T, member 10
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004693.1-83s1c1
Sequence:CCGGGCTTGCTTATCTTCAGTATATCTCGAGATATACTGAAGATAAGCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004693.1-513s1c1
Sequence:CCGGCCATGAGATTCAGCACTTCTTCTCGAGAAGAAGTGCTGAATCTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004693.1-633s1c1
Sequence:CCGGGACGGTCATTTCAGTGTCTTACTCGAGTAAGACACTGAAATGACCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004693.1-759s1c1
Sequence:CCGGAGCTGCTATTTACAACTACATCTCGAGATGTAGTTGTAAATAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004693.1-192s1c1
Sequence:CCGGCCAGCTCTCACTCATAGACTTCTCGAGAAGTCTATGAGTGAGAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)