EMAIL THIS PAGE TO A FRIEND

OR2T12

olfactory receptor, family 2, subfamily T, member 12

2 Gene Product Result for
Synonyms: OR1-57
UniProtKB ID: Q8NG77
Gene ID:
Human(127064) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(509217) olfactory receptor, family 2, subfamily T, member 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004692 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004692 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004692 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004692
OR2T12 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily T, member 12
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004692.1-241s1c1
Sequence:CCGGGCTGACTACTTGACCGGAAATCTCGAGATTTCCGGTCAAGTAGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004692.1-551s1c1
Sequence:CCGGGTTTGGCTTGTGCTGACACTTCTCGAGAAGTGTCAGCACAAGCCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004692.1-121s1c1
Sequence:CCGGGCCCTCATGATTCTCCTGATTCTCGAGAATCAGGAGAATCATGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004692.1-789s1c1
Sequence:CCGGCAGGTCCACTAACCACGATAACTCGAGTTATCGTGGTTAGTGGACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004692.1-108s1c1
Sequence:CCGGCCTGTTTAGCAATGCCCTCATCTCGAGATGAGGGCATTGCTAAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004692
OR2T12 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily T, member 12
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004692.1-241s1c1
Sequence:CCGGGCTGACTACTTGACCGGAAATCTCGAGATTTCCGGTCAAGTAGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004692.1-551s1c1
Sequence:CCGGGTTTGGCTTGTGCTGACACTTCTCGAGAAGTGTCAGCACAAGCCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004692.1-121s1c1
Sequence:CCGGGCCCTCATGATTCTCCTGATTCTCGAGAATCAGGAGAATCATGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004692.1-789s1c1
Sequence:CCGGCAGGTCCACTAACCACGATAACTCGAGTTATCGTGGTTAGTGGACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004692.1-108s1c1
Sequence:CCGGCCTGTTTAGCAATGCCCTCATCTCGAGATGAGGGCATTGCTAAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004692
OR2T12 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily T, member 12
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004692.1-241s1c1
Sequence:CCGGGCTGACTACTTGACCGGAAATCTCGAGATTTCCGGTCAAGTAGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004692.1-551s1c1
Sequence:CCGGGTTTGGCTTGTGCTGACACTTCTCGAGAAGTGTCAGCACAAGCCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004692.1-121s1c1
Sequence:CCGGGCCCTCATGATTCTCCTGATTCTCGAGAATCAGGAGAATCATGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004692.1-789s1c1
Sequence:CCGGCAGGTCCACTAACCACGATAACTCGAGTTATCGTGGTTAGTGGACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004692.1-108s1c1
Sequence:CCGGCCTGTTTAGCAATGCCCTCATCTCGAGATGAGGGCATTGCTAAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)