EMAIL THIS PAGE TO A FRIEND

OR2T29

olfactory receptor, family 2, subfamily T, member 29

9 Gene Product Result for
Species: Human OR2T29(343563)
UniProtKB ID: Q8NH02
Gene ID:
Human(343563) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107463 Anti-OR2T29 antibody produced in rabbit affinity isolated antibody guinea pig, horse, human, rabbit
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_291645 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_291645 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_291645 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004694 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004694 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230572 predicted 500
2 SASI_Hs01_00230574 predicted 287
3 SASI_Hs01_00230575 predicted 613
4 SASI_Hs01_00230576 predicted 580
5 SASI_Hs01_00230573 predicted 283
6 SASI_Hs01_00230577 predicted 66
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_291645
OR2T29 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily T, member 29
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291645.3-74s1c1
Sequence:CCGGCCAAACATCCAGCTCTACTTACTCGAGTAAGTAGAGCTGGATGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291645.3-139s1c1
Sequence:CCGGGCTGTCCTGATCCTTCTGATACTCGAGTATCAGAAGGATCAGGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291645.3-647s1c1
Sequence:CCGGCGATCATTTCAAGCTCCTATTCTCGAGAATAGGAGCTTGAAATGATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291645.3-214s1c1
Sequence:CCGGCTCATGGACATGGCGTACATTCTCGAGAATGTACGCCATGTCCATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291645.3-645s1c1
Sequence:CCGGGACGATCATTTCAAGCTCCTACTCGAGTAGGAGCTTGAAATGATCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291645.3-264s1c1
Sequence:CCGGCCAGGTCATGGGTGTGAATAACTCGAGTTATTCACACCCATGACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_291645
OR2T29 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily T, member 29
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291645.3-74s1c1
Sequence:CCGGCCAAACATCCAGCTCTACTTACTCGAGTAAGTAGAGCTGGATGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291645.3-139s1c1
Sequence:CCGGGCTGTCCTGATCCTTCTGATACTCGAGTATCAGAAGGATCAGGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000186899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291645.3-647s1c1
Sequence:CCGGCGATCATTTCAAGCTCCTATTCTCGAGAATAGGAGCTTGAAATGATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291645.3-214s1c1
Sequence:CCGGCTCATGGACATGGCGTACATTCTCGAGAATGTACGCCATGTCCATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291645.3-645s1c1
Sequence:CCGGGACGATCATTTCAAGCTCCTACTCGAGTAGGAGCTTGAAATGATCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291645.3-264s1c1
Sequence:CCGGCCAGGTCATGGGTGTGAATAACTCGAGTTATTCACACCCATGACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_291645
OR2T29 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily T, member 29
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291645.3-74s1c1
Sequence:CCGGCCAAACATCCAGCTCTACTTACTCGAGTAAGTAGAGCTGGATGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291645.3-139s1c1
Sequence:CCGGGCTGTCCTGATCCTTCTGATACTCGAGTATCAGAAGGATCAGGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000186899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291645.3-647s1c1
Sequence:CCGGCGATCATTTCAAGCTCCTATTCTCGAGAATAGGAGCTTGAAATGATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188405    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291645.3-214s1c1
Sequence:CCGGCTCATGGACATGGCGTACATTCTCGAGAATGTACGCCATGTCCATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291645.3-645s1c1
Sequence:CCGGGACGATCATTTCAAGCTCCTACTCGAGTAGGAGCTTGAAATGATCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204421    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_291645.3-264s1c1
Sequence:CCGGCCAGGTCATGGGTGTGAATAACTCGAGTTATTCACACCCATGACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)