EMAIL THIS PAGE TO A FRIEND

OR2T2

olfactory receptor, family 2, subfamily T, member 2

15 Gene Product Result for
Synonyms: OR1-43 OR2T2P
UniProtKB ID: Q6IF00, B2RNM1, B9EH01
Gene ID:
Human(401992) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(615374) olfactory receptor, family 2, subfamily T, member 2
dog(482240) olfactory receptor, family 2, subfamily T, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501777 Anti-OR2T2 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing
SAB4501779 Anti-OR2T2 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004136 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004136 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004136 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004136 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004136 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160575 predicted 396
2 SASI_Hs01_00160576 predicted 627
3 SASI_Hs01_00160577 predicted 653
4 SASI_Hs01_00160578 predicted 709
5 SASI_Hs01_00160580 predicted 544
6 SASI_Hs01_00160581 predicted 697
7 SASI_Hs02_00304483 predicted 210
8 SASI_Hs01_00160582 predicted 476
9 SASI_Hs01_00160583 predicted 373
10 SASI_Hs01_00160584 predicted 198
11 SASI_Hs01_00160579 predicted 216
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004136
OR2T2 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily T, member 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004136.1-414s1c1
Sequence:CCGGCCGCAGGGTTTGCTTATTCATCTCGAGATGAATAAGCAAACCCTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004136.1-707s1c1
Sequence:CCGGGCAAAGCCTTTGCTACGTGTTCTCGAGAACACGTAGCAAAGGCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004136.1-504s1c1
Sequence:CCGGCTTCTGTAGATCCCGAGAGATCTCGAGATCTCTCGGGATCTACAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004136.1-198s1c1
Sequence:CCGGGCTCTCCATCATGGATACCATCTCGAGATGGTATCCATGATGGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004136.1-88s1c1
Sequence:CCGGGCAATAGTCTTCTCCATCTTTCTCGAGAAAGATGGAGAAGACTATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004136
OR2T2 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily T, member 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004136.1-414s1c1
Sequence:CCGGCCGCAGGGTTTGCTTATTCATCTCGAGATGAATAAGCAAACCCTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004136.1-707s1c1
Sequence:CCGGGCAAAGCCTTTGCTACGTGTTCTCGAGAACACGTAGCAAAGGCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004136.1-504s1c1
Sequence:CCGGCTTCTGTAGATCCCGAGAGATCTCGAGATCTCTCGGGATCTACAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004136.1-198s1c1
Sequence:CCGGGCTCTCCATCATGGATACCATCTCGAGATGGTATCCATGATGGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004136.1-88s1c1
Sequence:CCGGGCAATAGTCTTCTCCATCTTTCTCGAGAAAGATGGAGAAGACTATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004136
OR2T2 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily T, member 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004136.1-414s1c1
Sequence:CCGGCCGCAGGGTTTGCTTATTCATCTCGAGATGAATAAGCAAACCCTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004136.1-707s1c1
Sequence:CCGGGCAAAGCCTTTGCTACGTGTTCTCGAGAACACGTAGCAAAGGCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004136.1-504s1c1
Sequence:CCGGCTTCTGTAGATCCCGAGAGATCTCGAGATCTCTCGGGATCTACAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004136.1-198s1c1
Sequence:CCGGGCTCTCCATCATGGATACCATCTCGAGATGGTATCCATGATGGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004136.1-88s1c1
Sequence:CCGGGCAATAGTCTTCTCCATCTTTCTCGAGAAAGATGGAGAAGACTATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)