EMAIL THIS PAGE TO A FRIEND

OR2T33

olfactory receptor, family 2, subfamily T, member 33

5 Gene Product Result for
Synonyms: OR1-56
UniProtKB ID: Q8NG76, B2RNN0
Gene ID:
Human(391195) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
cow(616651) olfactory receptor, family 2, subfamily T, member 33
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004695 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004695 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004695 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004695 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004695 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153858 predicted 425
2 SASI_Hs01_00153859 predicted 786
3 SASI_Hs01_00153860 predicted 107
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004695
OR2T33 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily T, member 33
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004695.1-779s1c1
Sequence:CCGGCCAAATCCCATAGGTCCACTACTCGAGTAGTGGACCTATGGGATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004695.1-196s1c1
Sequence:CCGGCTCATGGACATGATGCTGGTTCTCGAGAACCAGCATCATGTCCATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004695.1-243s1c1
Sequence:CCGGTGACTACTTGACCGGAAGTAACTCGAGTTACTTCCGGTCAAGTAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004695.1-807s1c1
Sequence:CCGGCAAGGTTGTGTCAGCCTTCTACTCGAGTAGAAGGCTGACACAACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004695.1-111s1c1
Sequence:CCGGGTTTGGCAATTCCCTCATGATCTCGAGATCATGAGGGAATTGCCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004695
OR2T33 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily T, member 33
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004695.1-779s1c1
Sequence:CCGGCCAAATCCCATAGGTCCACTACTCGAGTAGTGGACCTATGGGATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004695.1-196s1c1
Sequence:CCGGCTCATGGACATGATGCTGGTTCTCGAGAACCAGCATCATGTCCATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004695.1-243s1c1
Sequence:CCGGTGACTACTTGACCGGAAGTAACTCGAGTTACTTCCGGTCAAGTAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004695.1-807s1c1
Sequence:CCGGCAAGGTTGTGTCAGCCTTCTACTCGAGTAGAAGGCTGACACAACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004695.1-111s1c1
Sequence:CCGGGTTTGGCAATTCCCTCATGATCTCGAGATCATGAGGGAATTGCCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004695
OR2T33 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily T, member 33
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004695.1-779s1c1
Sequence:CCGGCCAAATCCCATAGGTCCACTACTCGAGTAGTGGACCTATGGGATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004695.1-196s1c1
Sequence:CCGGCTCATGGACATGATGCTGGTTCTCGAGAACCAGCATCATGTCCATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004695.1-243s1c1
Sequence:CCGGTGACTACTTGACCGGAAGTAACTCGAGTTACTTCCGGTCAAGTAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004695.1-807s1c1
Sequence:CCGGCAAGGTTGTGTCAGCCTTCTACTCGAGTAGAAGGCTGACACAACCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004695.1-111s1c1
Sequence:CCGGGTTTGGCAATTCCCTCATGATCTCGAGATCATGAGGGAATTGCCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)