EMAIL THIS PAGE TO A FRIEND

OR2T35

olfactory receptor, family 2, subfamily T, member 35

26 Gene Product Result for
Species: Human OR2T35(403244)
UniProtKB ID: Q8NGX2, Q6IEY7
Gene ID:
Human(403244) Summary: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001827 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001827 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001827 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001827 Rosetta Predictions human pricing
XM_001713871 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001827 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041267 predicted 398
2 SASI_Hs01_00041268 predicted 621
3 SASI_Hs01_00041269 predicted 655
4 SASI_Hs01_00041270 predicted 711
5 SASI_Hs01_00041273 predicted 540
6 SASI_Hs01_00041274 predicted 702
7 SASI_Hs02_00303955 predicted 210
8 SASI_Hs01_00041275 predicted 474
9 SASI_Hs01_00041276 predicted 367
10 SASI_Hs02_00303956 predicted 202
11 SASI_Hs01_00041271 predicted 214
12 SASI_Hs01_00041272 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713871 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00393496 predicted 405
2 SASI_Hs02_00393497 predicted 622
3 SASI_Hs02_00393498 predicted 650
4 SASI_Hs02_00393499 predicted 707
5 SASI_Hs02_00393500 predicted 549
6 SASI_Hs02_00393501 predicted 689
7 SASI_Hs02_00393502 predicted 206
8 SASI_Hs02_00393503 predicted 476
9 SASI_Hs02_00393504 predicted 371
10 SASI_Hs02_00393505 predicted 196
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001827
OR2T35 MISSION shRNA Bacterial Glycerol Stock
olfactory receptor, family 2, subfamily T, member 35
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000188537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001827.1-411s1c1
Sequence:CCGGCCGCAGGGTTTGCTTATTCATCTCGAGATGAATAAGCAAACCCTGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001827.1-101s1c1
Sequence:CCGGCCATCTTTGTGGTGGCTATAACTCGAGTTATAGCCACCACAAAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001827.1-88s1c1
Sequence:CCGGGCAGTAGTCTTCTCCATCTTTCTCGAGAAAGATGGAGAAGACTACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001827.1-198s1c1
Sequence:CCGGGCTCTCCATCATGGATACCATCTCGAGATGGTATCCATGATGGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001827.1-704s1c1
Sequence:CCGGGCAAAGCCTTTGCTACGTGTTCTCGAGAACACGTAGCAAAGGCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001827.1-78s1c2
Sequence:CCGGGCTTCTCTTTGCAGTAGTCTTCTCGAGAAGACTACTGCAAAGAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001827
OR2T35 MISSION shRNA shRNA Plasmid DNA
olfactory receptor, family 2, subfamily T, member 35
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000188537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001827.1-411s1c1
Sequence:CCGGCCGCAGGGTTTGCTTATTCATCTCGAGATGAATAAGCAAACCCTGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001827.1-101s1c1
Sequence:CCGGCCATCTTTGTGGTGGCTATAACTCGAGTTATAGCCACCACAAAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000187850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001827.1-88s1c1
Sequence:CCGGGCAGTAGTCTTCTCCATCTTTCTCGAGAAAGATGGAGAAGACTACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001827.1-198s1c1
Sequence:CCGGGCTCTCCATCATGGATACCATCTCGAGATGGTATCCATGATGGAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001827.1-704s1c1
Sequence:CCGGGCAAAGCCTTTGCTACGTGTTCTCGAGAACACGTAGCAAAGGCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001827.1-78s1c2
Sequence:CCGGGCTTCTCTTTGCAGTAGTCTTCTCGAGAAGACTACTGCAAAGAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001827
OR2T35 MISSION shRNA Lentiviral Transduction Particles
olfactory receptor, family 2, subfamily T, member 35
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000188537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001827.1-411s1c1
Sequence:CCGGCCGCAGGGTTTGCTTATTCATCTCGAGATGAATAAGCAAACCCTGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001827.1-101s1c1
Sequence:CCGGCCATCTTTGTGGTGGCTATAACTCGAGTTATAGCCACCACAAAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000187850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001827.1-88s1c1
Sequence:CCGGGCAGTAGTCTTCTCCATCTTTCTCGAGAAAGATGGAGAAGACTACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001827.1-198s1c1
Sequence:CCGGGCTCTCCATCATGGATACCATCTCGAGATGGTATCCATGATGGAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001827.1-704s1c1
Sequence:CCGGGCAAAGCCTTTGCTACGTGTTCTCGAGAACACGTAGCAAAGGCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001827.1-78s1c2
Sequence:CCGGGCTTCTCTTTGCAGTAGTCTTCTCGAGAAGACTACTGCAAAGAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)